Products
Services
Research Areas
COVID-19
Resources
Contact Us
Distributors
Login
Quick Order
Cart
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Services
Immunohistochemistry Services

Work with LifeSpan to design a custom immunohistochemistry to address your specific biological question. Outsource the entire localization process without having to worry about finding and characterizing target specific antibodies, sourcing and validating difficult-to-find tissues, and having the ability to interpret the resulting immunostaining in relation to complex human pathologies.

TCR Screening Services

Test your therapeutic antibodies in immunohistochemistry against a broad panel of normal frozen human tissue types in order to determine potential unintended binding. Our non-GLP TCR services are designed on the FDA recommendation outlined in their "Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use".

Research Areas
Cell Cycle Pathways
Protein Family And Group
Infectious Disease
Contact Us
LSBio
2401 Fourth Avenue Suite 900
Seattle WA 98121
Phone:
866-819-4732 (Toll Free North America
206-374-1102 (International)
Fax:
866-206-6909 (Toll Free North America)
206-577-4565 (International)
How To Buy - Details about how to buy our products.
Orders@LSBio.com - To submit a new order.
Customer.Support@LSBio.com - To submit questions about existing orders, pricing, availability, bulk quotes, froforma invoice requests, or other billing issues.
Technical.Support@LSBio.com - To request technical information about an LSBio product or its applications
Sales@LSBio.com - To request information about fee-for-service contract IHC studies, IHC reports, distribution agreements, or general business development.
Worldwide Distributors List - To find your local distributor if you're not within the United States.
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Catalog Number Size Price
LS-N56537-1 1 Each $525 
PKLR NucleicAcid

Human PKLR Expression-Ready ORF Clone (pLV-C-GFP) LS-N56537

Human PKLR Expression-Ready ORF Clone (pLV-C-GFP) LS-N56537

Description:
Human PKLR Expression-Ready ORF Clone in Lentiviral Expression Vector pLV-C-GFP, with C-Terminal GFP tag. Approximately 10 ug per unit.
Vector:
Expression Vector pLV-C-GFP
Other formats:
Price
Catalog Number
$525 
LS-N56537-1
1 Each

Estimated Shipping: 20 Business Days
Toll Free North America
866-819-4732
For Research Use Only

Overview

Description:
Human PKLR Expression-Ready ORF Clone in Lentiviral Expression Vector pLV-C-GFP, with C-Terminal GFP tag. Approximately 10 ug per unit.
Vector:
Expression Vector pLV-C-GFP
Other formats:

Specifications

Type
Expression-Ready ORF Clone
Target
PKLR
Synonyms
PKLR | PKL | Pyruvate kinase, liver and RBC | Pyruvate kinase type L | Red cell/liver pyruvate kinase | RPK | PK1 | PKR | Pyruvate kinase 1 | Pyruvate kinase isozymes R/L | R-type/L-type pyruvate kinase | PKRL | Pyruvate kinase isozyme R/L
Species
Human
Insert Size
1725 bp
Cloning Enzymes Used
This construct is not yet assembled.
Presentation
Lyophilized
Reconstitution
  • Centrifuge at 5,000 x g for 5 minutes.
  • Carefully open the tube and add 100 µl of sterile water to dissolve the DNA.
  • Close the tube and incubate for 10 minutes at room temperature.
  • Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5,000 x g.
  • Store the plasmid at -20°C.
Storage
Store lyophilized at room temperature for up to three months.
Validation
The insert is confirmed by full-length sequencing with the sequencing primers listed.
Restrictions
For research use only. Intended for use by laboratory professionals.
Guarantee
This Expression-Ready ORF Clone carries the LSBio 100% Guarantee.
LSBio Guarantee
Vector
pLV-C-GFP
Vector Type
Expression Vector
Vector Information
This lentiviral vector is designed for stable integrated expression in mammalian hosts. It contains the following elements:
5'LTR: Required for viral packaging and transcription, but the native promoter is replaced with a CMV promoter to prevent replication of the viral sequences.
Psi: Packaging signal.
RRE: Rev response element binds gag and increases viral titers by promoting the nuclear export of unspliced viral genomic RNA.
cPPT/cTS: Central polypurine tract increases nuclear translocation and efficiency of integration of transduced viral genomes.
CMV2 promoter: This promoter results in a high level of expression in a wide variety of cell lines.
WPRE: Woodchuck Hepatitis Virus posttranscriptional regulatory element prevents poly A readthrough.
3' LTR: Required for viral reverse transcription, this self-inactivating 3' LTR contains a deletion in the U3 region which prevents formation of replication-competent viral particles after integration into genomic DNA.
Expression System
Lentiviral
Expression Method
Constitutive, Stable/Transient
Promoter
CMV
Sequencing Primers
pLen-F - 5' CTCGTTTAGTGAACCGTCAGAATT 3'
pLen-R - 5' GAACCGGAACCCTTAAACATGT 3'
Vector Size
7395 bp
Vector Sequence
1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTGCACTCT CAGTACAATC 51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT 101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG 151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG 201 CTGCTTCGCG ATGTACGGGC CAGATATCGC GTTGACATTG ATTATTGACT 251 AGTTATTAAT AGTAATCAAT TACGGGGTCA TTAGTTCATA GCCCATATAT 301 GGAGTTCCGC GTTACATAAC TTACGGTAAA TGGCCCGCCT GGCTGACCGC 351 CCAACGACCC CCGCCCATTG ACGTCAATAA TGACGTATGT TCCCATAGTA 401 ACGCCAATAG GGACTTTCCA TTGACGTCAA TGGGTGGAGT ATTTACGGTA 451 AACTGCCCAC TTGGCAGTAC ATCAAGTGTA TCATATGCCA AGTACGCCCC 501 CTATTGACGT CAATGACGGT AAATGGCCCG CCTGGCATTA TGCCCAGTAC 551 ATGACCTTAT GGGACTTTCC TACTTGGCAG TACATCTACG TATTAGTCAT 601 CGCTATTACC ATGGTGATGC GGTTTTGGCA GTACATCAAT GGGCGTGGAT 651 AGCGGTTTGA CTCACGGGGA TTTCCAAGTC TCCACCCCAT TGACGTCAAT 701 GGGAGTTTGT TTTGGCACCA AAATCAACGG GACTTTCCAA AATGTCGTAA 751 CAACTCCGCC CCATTGACGC AAATGGGCGG TAGGCGTGTA CGGTGGGAGG 801 TCTATATAAG CAGCGCGTTT TGCCTGTACT GGGTCTCTCT GGTTAGACCA 851 GATCTGAGCC TGGGAGCTCT CTGGCTAACT AGGGAACCCA CTGCTTAAGC 901 CTCAATAAAG CTTGCCTTGA GTGCTTCAAG TAGTGTGTGC CCGTCTGTTG 951 TGTGACTCTG GTAACTAGAG ATCCCTCAGA CCCTTTTAGT CAGTGTGGAA 1001 AATCTCTAGC AGTGGCGCCC GAACAGGGAC TTGAAAGCGA AAGGGAAACC 1051 AGAGGAGCTC TCTCGACGCA GGACTCGGCT TGCTGAAGCG CGCACGGCAA 1101 GAGGCGAGGG GCGGCGACTG GTGAGTACGC CAAAAATTTT GACTAGCGGA 1151 GGCTAGAAGG AGAGAGATGG GTGCGAGAGC GTCAGTATTA AGCGGGGGAG 1201 AATTAGATCG CGATGGGAAA AAATTCGGTT AAGGCCAGGG GGAAAGAAAA 1251 AATATAAATT AAAACATATA GTATGGGCAA GCAGGGAGCT AGAACGATTC 1301 GCAGTTAATC CTGGCCTGTT AGAAACATCA GAAGGCTGTA GACAAATACT 1351 GGGACAGCTA CAACCATCCC TTCAGACAGG ATCAGAAGAA CTTAGATCAT 1401 TATATAATAC AGTAGCAACC CTCTATTGTG TGCATCAAAG GATAGAGATA 1451 AAAGACACCA AGGAAGCTTT AGACAAGATA GAGGAAGAGC AAAACAAAAG 1501 TAAGACCACC GCACAGCAAG CGGCCGGCCG CTGATCTTCA GACCTGGAGG 1551 AGGAGATATG AGGGACAATT GGAGAAGTGA ATTATATAAA TATAAAGTAG 1601 TAAAAATTGA ACCATTAGGA GTAGCACCCA CCAAGGCAAA GAGAAGAGTG 1651 GTGCAGAGAG AAAAAAGAGC AGTGGGAATA GGAGCTTTGT TCCTTGGGTT 1701 CTTGGGAGCA GCAGGAAGCA CTATGGGCGC AGCGTCAATG ACGCTGACGG 1751 TACAGGCCAG ACAATTATTG TCTGGTATAG TGCAGCAGCA GAACAATTTG 1801 CTGAGGGCTA TTGAGGCGCA ACAGCATCTG TTGCAACTCA CAGTCTGGGG 1851 CATCAAGCAG CTCCAGGCAA GAATCCTGGC TGTGGAAAGA TACCTAAAGG 1901 ATCAACAGCT CCTGGGGATT TGGGGTTGCT CTGGAAAACT CATTTGCACC 1951 ACTGCTGTGC CTTGGAATGC TAGTTGGAGT AATAAATCTC TGGAACAGAT 2001 TTGGAATCAC ACGACCTGGA TGGAGTGGGA CAGAGAAATT AACAATTACA 2051 CAAGCTTAAT ACACTCCTTA ATTGAAGAAT CGCAAAACCA GCAAGAAAAG 2101 AATGAACAAG AATTATTGGA ATTAGATAAA TGGGCAAGTT TGTGGAATTG 2151 GTTTAACATA ACAAATTGGC TGTGGTATAT AAAATTATTC ATAATGATAG 2201 TAGGAGGCTT GGTAGGTTTA AGAATAGTTT TTGCTGTACT TTCTATAGTG 2251 AATAGAGTTA GGCAGGGATA TTCACCATTA TCGTTTCAGA CCCACCTCCC 2301 AACCCCGAGG GGACCCGACA GGCCCGAAGG AATAGAAGAA GAAGGTGGAG 2351 AGAGAGACAG AGACAGATCC ATTCGATTAG TGAACGGATC GGCACTGCGT 2401 GCGCCAATTC TGCAGACAAA TGGCAGTATT CATCCACAAT TTTAAAAGAA 2451 AAGGGGGGAT TGGGGGGTAC AGTGCAGGGG AAAGAATAGT AGACATAATA 2501 GCAACAGACA TACAAACTAA AGAATTACAA AAACAAATTA CAAAAATTCA 2551 AAATTTTCGG GTTTATTACA GGGACAGCAG AGATCCAGTT TGGTTAGTAC 2601 CGGGCCCGCT CTAGAGGATC CGGCTGTGGA ATGTGTGTCA GTTAGGGTGT 2651 GGAAAGTCCC CAGGCTCCCC AGCAGGCAGA AGTATGCAAA GCATGCATCA 2701 CAATTAGTCA GCAACCAAAC GACCCCCGCC CATTGACGTC AATAATGACG 2751 TATGTTCCCA TAGTAACGCC AATAGGGACT TTCCATTGAC GTCAATGGGT 2801 GGAGTATTTA CGGTAAACTG CCCACTTGGC AGTACATCAA GTGTATCATA 2851 TGCCAAGTCC GCCCCCTATT GACGTCAATG ACGGTAAATG GCCCGCCTGG 2901 CATTATGCCC AGTACATGAC CTTACGGGAC TTTCCTACTT GGCAGTACAT 2951 CTACGTATTA GTCATCGCTA TTACCATGGT GATGCGGTTT TGGCAGTACA 3001 CCAATGGGCG TGGATAGCGG TTTGACTCAC GGGGATTTCC AAGTCTCCAC 3051 CCCATTGACG TCAATGGGAG TTTGTTTTGG CACCAAAATC AACGGGACTT 3101 TCCAAAATGT CGTAATAACC CCGCCCCGTT GACGCAAATG GGCGGTAGGC 3151 GTGTACGGTG GGAGGTCTAT ATAAGCAGAG CTCGTTTAGT GAACCGTCAG 3201 AATTTTGTAA TACGACTCAC TATAGGGCGG CCGGGAATTC TAATACGACT 3251 CACTATAGGG GCCGCCACCA AGCTTGGTAC CGCTAGCGGA TCCGTTAACC 3301 TTAAGACCGG TATGGGCTGG TCCTGCATCA TCCTGTTCCT CGTGGCGACC 3351 GCGACCGGGG TCCACAGCGA TATCATCGAT AGCGCTCCCG GGGGTGGAGG 3401 CTCTGTGAGC AAGGGCGAGG AGCTGTTCAC CGGGGTGGTG CCCATCCTGG 3451 TCGAGCTGGA CGGCGACGTA AACGGCCACA AGTTCAGCGT GTCCGGCGAG 3501 GGCGAGGGCG ATGCCACCTA CGGCAAGCTG ACCCTGAAGT TCATCTGCAC 3551 CACCGGCAAG CTGCCCGTGC CCTGGCCCAC CCTCGTGACC ACCCTGACCT 3601 ACGGCGTGCA GTGCTTCAGC CGCTACCCCG ACCACATGAA GAAGCACGAC 3651 TTCTTCAAGT CCGCCATGCC CGAAGGCTAC GTCCAGGAGC GCACCATCTT 3701 CTTCAAGGAC GACGGCAACT ACAAGACCCG CGCCGAGGTG AAGTTCGAGG 3751 GCGACACCCT GGTGAACCGC ATCGAGCTGA AGGGCATCGA CTTCAAGGAG 3801 GACGGCAACA TCCTGGGGCA CAAGCTGGAG TACAACTACA ACAGCCACAA 3851 CGTCTATATC ATGGCCGACA AGCAGAAGAA CGGCATCAAG GCTAACTTCA 3901 AGGTTCGCCA CAACATCGAG GACGGCAGCG TGCAGCTCGC CGACCACTAC 3951 CAGCAGAACA CCCCCATCGG CGACGGCCCC GTGCTGCTGC CCGACAACCA 4001 CTACCTGAGC ACCCAGTCCG CCCTGAGCAA AGACCCCAAC GAGAAGCGCG 4051 ATCACATGGT CCTGCTGGAG TTCGTGACCG CCGCCGGGAT CACTCTCGGC 4101 ATGGACGAGC TGTACAAGTA AACTCGAGTC TGCGGCCGCC GTTTAAACGG 4151 CCGGCCGCGG TCTGTACAAG TAGGATTCGT CGAGGGACCT AATAACTTCG 4201 TATAGCATAC ATTATACGAA GTTATACATG TTTAAGGGTT CCGGTTCCAC 4251 TAGGTACAAT TCGATATCAA GCTTATCGAT AATCAACCTC TGGATTACAA 4301 AATTTGTGAA AGATTGACTG GTATTCTTAA CTATGTTGCT CCTTTTACGC 4351 TATGTGGATA CGCTGCTTTA ATGCCTTTGT ATCATGCTAT TGCTTCCCGT 4401 ATGGCTTTCA TTTTCTCCTC CTTGTATAAA TCCTGGTTGC TGTCTCTTTA 4451 TGAGGAGTTG TGGCCCGTTG TCAGGCAACG TGGCGTGGTG TGCACTGTGT 4501 TTGCTGACGC AACCCCCACT GGTTGGGGCA TTGCCACCAC CTGTCAGCTC 4551 CTTTCCGGGA CTTTCGCTTT CCCCCTCCCT ATTGCCACGG CGGAACTCAT 4601 CGCCGCCTGC CTTGCCCGCT GCTGGACAGG GGCTCGGCTG TTGGGCACTG 4651 ACAATTCCGT GGTGTTGTCG GGGAAATCAT CGTCCTTTCC TTGGCTGCTC 4701 GCCTGTGTTG CCACCTGGAT TCTGCGCGGG ACGTCCTTCT GCTACGTCCC 4751 TTCGGCCCTC AATCCAGCGG ACCTTCCTTC CCGCGGCCTG CTGCCGGCTC 4801 TGCGGCCTCT TCCGCGTCTT CGCCTTCGCC CTCAGACGAG TCGGATCTCC 4851 CTTTGGGCCG CCTCCCCGCA TCGATACCGT CGACCTCGAT CGAGACCTAG 4901 AAAAACATGG AGCAATCACA AGTAGCAATA CAGCAGCTAC CAATGCTGAT 4951 TGTGCCTGGC TAGAAGCACA AGAGGAGGAG GAGGTGGGTT TTCCAGTCAC 5001 ACCTCAAGTA CCTTTAAGAC CAATGACTTA CAAGGCAGCT GTAGATCTTA 5051 GCCACTTTTT AAAAGAAAAG GGGGGACTGG AAGGGCTAAT TCACTCCCAA 5101 CGAAGACAAG ATATCCTTGA TCTGTGGATC TACCACACAC AAGGCTACTT 5151 CCCTGATTGG CAGAACTACA CACCAGGGCC AGGGATCAGA TATCCACTGA 5201 CCTTTGGATG GTGCTACAAG CTAGTACCAG TTGAGCAAGA GAAGGTAGAA 5251 GAAGCCAATG AAGGAGAGAA CACCCGCTTG TTACACCCTG TGAGCCTGCA 5301 TGGGATGGAT GACCCGGAGA GAGAAGTATT AGAGTGGAGG TTTGACAGCC 5351 GCCTAGCATT TCATCACATG GCCCGAGAGC TGCATCCGGA CTGTACTGGG 5401 TCTCTCTGGT TAGACCAGAT CTGAGCCTGG GAGCTCTCTG GCTAACTAGG 5451 GAACCCACTG CTTAAGCCTC AATAAAGCTT GCCTTGAGTG CTTCAAGTAG 5501 TGTGTGCCCG TCTGTTGTGT GACTCTGGTA ACTAGAGATC CCTCAGACCC 5551 TTTTAGTCAG TGTGGAAAAT CTCTAGCAGC ATGTGAGCAA AAGGCCAGCA 5601 AAAGGCCAGG AACCGTAAAA AGGCCGCGTT GCTGGCGTTT TTCCATAGGC 5651 TCCGCCCCCC TGACGAGCAT CACAAAAATC GACGCTCAAG TCAGAGGTGG 5701 CGAAACCCGA CAGGACTATA AAGATACCAG GCGTTTCCCC CTGGAAGCTC 5751 CCTCGTGCGC TCTCCTGTTC CGACCCTGCC GCTTACCGGA TACCTGTCCG 5801 CCTTTCTCCC TTCGGGAAGC GTGGCGCTTT CTCATAGCTC ACGCTGTAGG 5851 TATCTCAGTT CGGTGTAGGT CGTTCGCTCC AAGCTGGGCT GTGTGCACGA 5901 ACCCCCCGTT CAGCCCGACC GCTGCGCCTT ATCCGGTAAC TATCGTCTTG 5951 AGTCCAACCC GGTAAGACAC GACTTATCGC CACTGGCAGC AGCCACTGGT 6001 AACAGGATTA GCAGAGCGAG GTATGTAGGC GGTGCTACAG AGTTCTTGAA 6051 GTGGTGGCCT AACTACGGCT ACACTAGAAG AACAGTATTT GGTATCTGCG 6101 CTCTGCTGAA GCCAGTTACC TTCGGAAAAA GAGTTGGTAG CTCTTGATCC 6151 GGCAAACAAA CCACCGCTGG TAGCGGTGGT TTTTTTGTTT GCAAGCAGCA 6201 GATTACGCGC AGAAAAAAAG GATCTCAAGA AGATCCTTTG ATCTTTTCTA 6251 CGGGGTCTGA CGCTCAGTGG AACGAAAACT CACGTTAAGG GATTTTGGTC 6301 ATGAGATTAT CAAAAAGGAT CTTCACCTAG ATCCTTTTAA ATTAAAAATG 6351 AAGTTTTAAA TCAATCTAAA GTATATATGA GTAAACTTGG TCTGACAGTT 6401 ACCAATGCTT AATCAGTGAG GCACCTATCT CAGCGATCTG TCTATTTCGT 6451 TCATCCATAG TTGCCTGACT CCCCGTCGTG TAGATAACTA CGATACGGGA 6501 GGGCTTACCA TCTGGCCCCA GTGCTGCAAT GATACCGCGA GACCCACGCT 6551 CACCGGCTCC AGATTTATCA GCAATAAACC AGCCAGCCGG AAGGGCCGAG 6601 CGCAGAAGTG GTCCTGCAAC TTTATCCGCC TCCATCCAGT CTATTAATTG 6651 TTGCCGGGAA GCTAGAGTAA GTAGTTCGCC AGTTAATAGT TTGCGCAACG 6701 TTGTTGCCAT TGCTACAGGC ATCGTGGTGT CACGCTCGTC GTTTGGTATG 6751 GCTTCATTCA GCTCCGGTTC CCAACGATCA AGGCGAGTTA CATGATCCCC 6801 CATGTTGTGC AAAAAAGCGG TTAGCTCCTT CGGTCCTCCG ATCGTTGTCA 6851 GAAGTAAGTT GGCCGCAGTG TTATCACTCA TGGTTATGGC AGCACTGCAT 6901 AATTCTCTTA CTGTCATGCC ATCCGTAAGA TGCTTTTCTG TGACTGGTGA 6951 GTACTCAACC AAGTCATTCT GAGAATAGTG TATGCGGCGA CCGAGTTGCT 7001 CTTGCCCGGC GTCAATACGG GATAATACCG CGCCACATAG CAGAACTTTA 7051 AAAGTGCTCA TCATTGGAAA ACGTTCTTCG GGGCGAAAAC TCTCAAGGAT 7101 CTTACCGCTG TTGAGATCCA GTTCGATGTA ACCCACTCGT GCACCCAACT 7151 GATCTTCAGC ATCTTTTACT TTCACCAGCG TTTCTGGGTG AGCAAAAACA 7201 GGAAGGCAAA ATGCCGCAAA AAAGGGAATA AGGGCGACAC GGAAATGTTG 7251 AATACTCATA CTCTTCCTTT TTCAATATTA TTGAAGCATT TATCAGGGTT 7301 ATTGTCTCAT GAGCGGATAC ATATTTGAAT GTATTTAGAA AAATAAACAA 7351 ATAGGGGTTC CGCGCACATT TCCCCGAAAA GTGCCACCTG ACGTC
Vector Tag
GFP, C-terminus
Tag Information
A GFP-tag (green fluorescent protein) possesses bright green fluorescence (excitation/emission max = 487/508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. The GFP-tag is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is especially recommended for cell and organelle labeling and tracking promoter activity.
Usage Summary
Most commercially available competent cells are appropriate for propagation of the plasmid, e.g. TOP10, DH5a, and TOP10F’.
About PKLR
P30613 NM_000298 NP_000289.1

Publications (0)

Customer Reviews (0)

Images

PKLR NucleicAcid

PKLR NucleicAcid

PKLR NucleicAcid

PKLR NucleicAcid

Requested From: United States
Date Requested: 8/9/2020