Products
Services
Research Areas
COVID-19
Resources
Contact Us
Distributors
Login
Quick Order
Cart
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Services
Immunohistochemistry Services

Work with LifeSpan to design a custom immunohistochemistry to address your specific biological question. Outsource the entire localization process without having to worry about finding and characterizing target specific antibodies, sourcing and validating difficult-to-find tissues, and having the ability to interpret the resulting immunostaining in relation to complex human pathologies.

TCR Screening Services

Test your therapeutic antibodies in immunohistochemistry against a broad panel of normal frozen human tissue types in order to determine potential unintended binding. Our non-GLP TCR services are designed on the FDA recommendation outlined in their "Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use".

Research Areas
Cell Cycle Pathways
Protein Family And Group
Infectious Disease
Contact Us
LSBio
2401 Fourth Avenue Suite 900
Seattle WA 98121
Phone:
866-819-4732 (Toll Free North America
206-374-1102 (International)
Fax:
866-206-6909 (Toll Free North America)
206-577-4565 (International)
How To Buy - Details about how to buy our products.
Orders@LSBio.com - To submit a new order.
Customer.Support@LSBio.com - To submit questions about existing orders, pricing, availability, bulk quotes, froforma invoice requests, or other billing issues.
Technical.Support@LSBio.com - To request technical information about an LSBio product or its applications
Sales@LSBio.com - To request information about fee-for-service contract IHC studies, IHC reports, distribution agreements, or general business development.
Worldwide Distributors List - To find your local distributor if you're not within the United States.
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Catalog Number Size Price
LS-N53178-1 1 Each $216 
OAS2 NucleicAcid

Human OAS2 Expression-Ready ORF Clone (pCMV3-C-HA) LS-N53178

Human OAS2 Expression-Ready ORF Clone (pCMV3-C-HA) LS-N53178

Description:
Human OAS2 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-C-HA, with C-Terminal HA tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-C-HA
Other formats:
Price
Catalog Number
$216 
LS-N53178-1
1 Each

Estimated Shipping: 20 Business Days
Toll Free North America
866-819-4732
For Research Use Only

Overview

Description:
Human OAS2 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-C-HA, with C-Terminal HA tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-C-HA
Other formats:

Specifications

Type
Expression-Ready ORF Clone
Target
OAS2
Synonyms
OAS2 | 2-5A synthase 2 | 2-5-oligoadenylate synthase 2 | p69OAS / p71OAS | p69 OAS / p71 OAS
Species
Human
Insert Size
2064 bp
Cloning Enzymes Used
This construct is not yet assembled.
Presentation
Lyophilized
Reconstitution
  • Centrifuge at 5,000 x g for 5 minutes.
  • Carefully open the tube and add 100 µl of sterile water to dissolve the DNA.
  • Close the tube and incubate for 10 minutes at room temperature.
  • Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5,000 x g.
  • Store the plasmid at -20°C.
Storage
Store lyophilized at room temperature for up to three months.
Validation
The insert is confirmed by full-length sequencing with the sequencing primers listed.
Restrictions
For research use only. Intended for use by laboratory professionals.
Guarantee
This Expression-Ready ORF Clone carries the LSBio 100% Guarantee.
LSBio Guarantee
Vector
pCMV3-C-HA
Vector Type
Expression Vector
Vector Information
All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
  • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
  • Hygromycin resistance gene for selection in mammalian cell lines.
  • A Kozak consensus sequence to enhance mammalian expression.
CMV promoter: bp 250-837
Enhancer: bp 838-1445
SV40 early promoter: bp 2402-2771
Hygromycin ORF: bp 2789-3814
pUC origin: bp 4457-5130
Kanamycin ORF: bp 5204-6019
Expression System
Mammalian
Expression Method
Constitutive, Stable/Transient
Promoter
CMV
Sequencing Primers
T7 - 5' TAATACGACTCACTATAGGG 3'
BGH - 5' TAGAAGGCACAGTCGAGG 3'
Vector Size
6161 bp
Vector Sequence
1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTGCACTCT CAGTACAATC 51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT 101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG 151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG 201 CTGCTTCGCG AGTACATTTA TATTGGCTCA TGTCCAATAT GACCGCCATG 251 TTGACATTGA TTATTGACTA GTTATTAATA GTAATCAATT ACGGGGTCAT 301 TAGTTCATAG CCCATATATG GAGTTCCGCG TTACATAACT TACGGTAAAT 351 GGCCCGCCTG GCTGACCGCC CAACGACCCC CGCCCATTGA CGTCAATAAT 401 GACGTATGTT CCCATAGTAA CGCCAATAGG GACTTTCCAT TGACGTCAAT 451 GGGTGGAGTA TTTACGGTAA ACTGCCCACT TGGCAGTACA TCAAGTGTAT 501 CATATGCCAA GTCCGCCCCC TATTGACGTC AATGACGGTA AATGGCCCGC 551 CTGGCATTAT GCCCAGTACA TGACCTTACG GGACTTTCCT ACTTGGCAGT 601 ACATCTACGT ATTAGTCATC GCTATTACCA TGGTGATGCG GTTTTGGCAG 651 TACACCAATG GGCGTGGATA GCGGTTTGAC TCACGGGGAT TTCCAAGTCT 701 CCACCCCATT GACGTCAATG GGAGTTTGTT TTGGCACCAA AATCAACGGG 751 ACTTTCCAAA ATGTCGTAAT AACCCCGCCC CGTTGACGCA AATGGGCGGT 801 AGGCGTGTAC GGTGGGAGGT CTATATAAGC AGAGCTCGTT TAGTGAACCG 851 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTTGG 901 GCTCGCGGTT GAGGACAAAC TCTTCGCGGT CTTTCCAGTA CTCTTGGATC 951 GGAAACCCGT CGGCCTCCGA ACGGTACTCC GCCACCGAGG GACCTGAGCG 1001 AGTCCGCATC GACCGGATCG GAAAACCTCT CGAGAAAGGC GTCTAACCAG 1051 TCACAGTCGC AAGGTAGGCT GAGCACCGTG GCGGGCGGCA GCGGGTGGCG 1101 GTCGGGGTTG TTTCTGGCGG AGGTGCTGCT GATGATGTAA TTAAAGTAGG 1151 CGGTCTTGAG ACGGCGGATG GTCGAGGTGA GGTGTGGGTT TAGTGAACCG 1201 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTCAG 1251 GCTTGAGATC CAGCTGTTGG GGTGAGTACT CCCTCTCAAA AGCGGGCATT 1301 ACTTCTGCGC TAAGATTGTC AGTTTCCAAA AACGAGGAGG ATTTGATATT 1351 CACCTGGCCC GATCTGGCCA TACACTTGAG TGACAATGAC ATCCACTTTG 1401 CCTTTCTCTC CACAGGTGTC CACTCCCAGG TCCAAGTTTA AACTTTAATA 1451 CGACTCACTA TAGGGGCCGC CACCAAGCTT GGTACCGCTA GCGGATCCGT 1501 TAACCTTAAG ACCGGTATGG GCTGGTCCTG CATCATCCTG TTCCTCGTGG 1551 CGACCGCGAC CGGGGTCCAC AGCGATATCA TCGATAGCGC TCCCGGGGGT 1601 GGAGGCTCTT ATCCTTACGA CGTGCCTGAC TACGCCTAAA CTCGAGTCTA 1651 GAGCGGCCGC CGAATTCGGG CCCGTTTAAA CCCGCTGATC AGCCTCGACT 1701 GTGCCTTCTA GTTGCCAGCC ATCTGTTGTT TGCCCCTCCC CCGTGCCTTC 1751 CTTGACCCTG GAAGGTGCCA CTCCCACTGT CCTTTCCTAA TAAAATGAGG 1801 AAATTGCATC GCATTGTCTG AGTAGGTGTC ATTCTATTCT GGGGGGTGGG 1851 GTGGGGCAGG ACAGCAAGGG GGAGGATTGG GAAGACAATA GCAGGCATGC 1901 TGGGGATGCG GTGGGCTCTA TGGCTTCTGA GGCGGAAAGA ACCAGCTGGG 1951 GCTCTAGGGG GTATCCCCAC GCGCCCTGTA GCGGCGCATT AAGCGCGGCG 2001 GGTGTGGTGG TTACGCGCAG CGTGACCGCT ACACTTGCCA GCGCCCTAGC 2051 GCCCGCTCCT TTCGCTTTCT TCCCTTCCTT TCTCGCCACG TTCGCAGGCT 2101 TTCCCCGTCA AGCTCTAAAT CGGGGGCTCC CTTTAGGGTT CCGATTTAGT 2151 GCTTTACGGC ACCTCGACCC CAAAAAACTT GATTAGGGTG ATGGTTCACG 2201 TAGTGGGCCA TCGCCCTGAT AGACGGTTTT TCGCCCTTTG ACGTTGGAGT 2251 CCACGTTCTT TAATAGTGGA CTCTTGTTCC AAACTGGAAC AACACTCAAC 2301 CCTATCTCGG TCTATTCTTT TGATTTATAA GGGATTTTGC CGATTTCGGC 2351 CTATTGGTTA AAAAATGAGC TGATTTAACA AAAATTTAAC GCGAATTAAT 2401 TCTGTGGAAT GTGTGTCAGT TAGGGTGTGG AAAGTCCCCA GGCTCCCCAG 2451 CAGGCAGAAG TATGCAAAGC ATGCATCTCA ATTAGTCAGC AACCAGGTGT 2501 GGAAAGTCCC CAGGCTCCCC AGCAGGCAGA AGTATGCAAA GCATGCATCT 2551 CAATTAGTCA GCAACCATAG TCCCGCCCCT AACTCCGCCC ATCCCGCCCC 2601 TAACTCCGCC CAGTTCCGCC CATTCTCCGC CCCATGGCTG ACTAATTTTT 2651 TTTATTTATG CAGAGGCCGA GGCCGCCTCT GCCTCTGAGC TATTCCAGAA 2701 GTAGTGAGGA GGCTTTTTTG GAGGCCTAGG CTTTTGCAAA AAGCTCTCGG 2751 GAGCTTGTAT ATCCATTTTC GGATCTGATC AGCACGTGAT GAAAAAGCCT 2801 GAACTCACCG CGACGTCTGT CGAGAAGTTT CTGATCGAAA AGTTCGACAG 2851 CGTCTCCGAC CTGATGCAGC TCTCGGAGGG CGAAGAATCT CGTGCTTTCA 2901 GCTTCGATGT AGGAGGGCGT GGATATGTCC TGCGGGTAAA TAGCTGCGCC 2951 GATGGTTTCT ACAAAGATCG TTATGTTTAT CGGCACTTTG CATCGGCCGC 3001 GCTCCCGATT CCGGAAGTGC TTGACATTGG GGAATTCAGC GAGAGCCTGA 3051 CCTATTGCAT CTCCCGCCGT GCACAGGGTG TCACGTTGCA AGACCTGCCT 3101 GAAACCGAAC TGCCCGCTGT TCTGCAGCCG GTCGCGGAGG CCATGGATGC 3151 GATCGCTGCG GCCGATCTTA GCCAGACGAG CGGGTTCGGC CCATTCGGAC 3201 CGCAAGGAAT CGGTCAATAC ACTACATGGC GTGATTTCAT ATGCGCGATT 3251 GCTGATCCCC ATGTGTATCA CTGGCAAACT GTGATGGACG ACACCGTCAG 3301 TGCGTCCGTC GCGCAGGCTC TCGATGAGCT GATGCTTTGG GCCGAGGACT 3351 GCCCCGAAGT CCGGCACCTC GTGCACGCGG ATTTCGGCTC CAACAATGTC 3401 CTGACGGACA ATGGCCGCAT AACAGCGGTC ATTGACTGGA GCGAGGCGAT 3451 GTTCGGGGAT TCCCAATACG AGGTCGCCAA CATCTTCTTC TGGAGGCCGT 3501 GGTTGGCTTG TATGGAGCAG CAGACGCGCT ACTTCGAGCG GAGGCATCCG 3551 GAGCTTGCAG GATCGCCGCG GCTCCGGGCG TATATGCTCC GCATTGGTCT 3601 TGACCAACTC TATCAGAGCT TGGTTGACGG CAATTTCGAT GATGCAGCTT 3651 GGGCGCAGGG TCGATGCGAC GCAATCGTCC GATCCGGAGC CGGGACTGTC 3701 GGGCGTACAC AAATCGCCCG CAGAAGCGCG GCCGTCTGGA CCGATGGCTG 3751 TGTAGAAGTA CTCGCCGATA GTGGAAACCG ACGCCCCAGC ACTCGTCCGA 3801 GGGCAAAGGA ATAGCACGTG CTACGAGATT TCGATTCCAC CGCCGCCTTC 3851 TATGAAAGGT TGGGCTTCGG AATCGTTTTC CGGGACGCTG GCTGGATGAT 3901 CCTCCAGCGC GGGGATCTCA TGCTGGAGTT CTTCGCCCAC CCCAACTTGT 3951 TTATTGCAGC TTATAATGGT TACAAATAAA GCAATAGCAT CACAAATTTC 4001 ACAAATAAAG CATTTTTTTC ACTGCATTCT AGTTGTGGTT TGTCCAAACT 4051 CATCAATGTA TCTTATCATG TCTGTATACC GTCGACCTCT AGCTAGAGCT 4101 TGGCGTAATC ATGGTCATAG CTGTTTCCTG TGTGAAATTG TTATCCGCTC 4151 ACAATTCCAC ACAACATACG AGCCGGAAGC ATAAAGTGTA AAGCCTGGGG 4201 TGCCTAATGA GTGAGCTAAC TCACATTAAT TGCGTTGCGC TCACTGCCCG 4251 CTTTCCAGTC GGGAAACCTG TCGTGCCAGC TGCATTAATG AATCGGCCAA 4301 CGCGCGGGGA GAGGCGGTTT GCGTATTGGG CGCTCTTCCG CTTCCTCGCT 4351 CACTGACTCG CTGCGCTCGG TCGTTCGGCT GCGGCGAGCG GTATCAGCTC 4401 ACTCAAAGGC GGTAATACGG TTATCCACAG AATCAGGGGA TAACGCAGGA 4451 AAGAACATGT GAGCAAAAGG CCAGCAAAAG GCCAGGAACC GTAAAAAGGC 4501 CGCGTTGCTG GCGTTTTTCC ATAGGCTCCG CCCCCCTGAC GAGCATCACA 4551 AAAATCGACG CTCAAGTCAG AGGTGGCGAA ACCCGACAGG ACTATAAAGA 4601 TACCAGGCGT TTCCCCCTGG AAGCTCCCTC GTGCGCTCTC CTGTTCCGAC 4651 CCTGCCGCTT ACCGGATACC TGTCCGCCTT TCTCCCTTCG GGAAGCGTGG 4701 CGCTTTCTCA TAGCTCACGC TGTAGGTATC TCAGTTCGGT GTAGGTCGTT 4751 CGCTCCAAGC TGGGCTGTGT GCACGAACCC CCCGTTCAGC CCGACCGCTG 4801 CGCCTTATCC GGTAACTATC GTCTTGAGTC CAACCCGGTA AGACACGACT 4851 TATCGCCACT GGCAGCAGCC ACTGGTAACA GGATTAGCAG AGCGAGGTAT 4901 GTAGGCGGTG CTACAGAGTT CTTGAAGTGG TGGCCTAACT ACGGCTACAC 4951 TAGAAGAACA GTATTTGGTA TCTGCGCTCT GCTGAAGCCA GTTACCTTCG 5001 GAAAAAGAGT TGGTAGCTCT TGATCCGGCA AACAAACCAC CGCTGGTAGC 5051 GGTGGTTTTT TTGTTTGCAA GCAGCAGATT ACGCGCAGAA AAAAAGGATC 5101 TCAAGAAGAT CCTTTGATCT TTTCTACGGG GTCTGAGCGC GGAACCCCTA 5151 TTTGTTTATT TTTCTAAATA CATTCAAATA TGTATCCGCT CATGAATTAA 5201 TTCTTAGAAA AACTCATCGA GCATCAAATG AAACTGCAAT TTATTCATAT 5251 CAGGATTATC AATACCATAT TTTTGAAAAA GCCGTTTCTG TAATGAAGGA 5301 GAAAACTCAC CGAGGCAGTT CCATAGGATG GCAAGATCCT GGTATCGGTC 5351 TGCGATTCCG ACTCGTCCAA CATCAATACA ACCTATTAAT TTCCCCTCGT 5401 CAAAAATAAG GTTATCAAGT GAGAAATCAC CATGAGTGAC GACTGAATCC 5451 GGTGAGAATG GCAAAAGTTT ATGCATTTCT TTCCAGACTT GTTCAACAGG 5501 CCAGCCATTA CGCTCGTCAT CAAAATCACT CGCATCAACC AAACCGTTAT 5551 TCATTCGTGA TTGCGCCTGA GCGAGACGAA ATACGCGATC GCTGTTAAAA 5601 GGACAATTAC AAACAGGAAT CGAATGCAAC CGGCGCAGGA ACACTGCCAG 5651 CGCATCAACA ATATTTTCAC CTGAATCAGG ATATTCTTCT AATACCTGGA 5701 ATGCTGTTTT CCCAGGGATC GCAGTGGTGA GTAACCATGC ATCATCAGGA 5751 GTACGGATAA AATGCTTGAT GGTCGGAAGA GGCATAAATT CCGTCAGCCA 5801 GTTTAGTCTG ACCATCTCAT CTGTAACATC ATTGGCAACG CTACCTTTGC 5851 CATGTTTCAG AAACAACTCT GGCGCATCGG GCTTCCCATA CAATCGATAG 5901 ATTGTCGCAC CTGATTGCCC GACATTATCG CGAGCCCATT TATACCCATA 5951 TAAATCAGCA TCCATGTTGG AATTTAATCG CGGCCTAGAG CAAGACGTTT 6001 CCCGTTGAAT ATGGCTCATA ACACCCCTTG TATTACTGTT TATGTAAGCA 6051 GACAGTTTTA TTGTTCATGA CCAAAATCCC TTAACGTGAG TTTTCGTTCC 6101 ACTGAGCGTC AGACCCCGTA GAAATCCGCG CACATTTCCC CGAAAAGTGC 6151 CACCTGACGT C
Vector Tag
HA, C-terminus
Tag Information
Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA-tag is derived from the HA-molecule corresponding to amino acids 98-106 and has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA-tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins. The actual HA-tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3'. The amino acid sequence is: YPYDVPDYA.
Usage Summary
Most commercially available competent cells are appropriate for propagation of the plasmid, e.g. TOP10, DH5a, and TOP10F’.
About OAS2
P29728 NM_002535 NP_002526.2

Publications (0)

Customer Reviews (0)

Images

OAS2 NucleicAcid

OAS2 NucleicAcid

OAS2 NucleicAcid

OAS2 NucleicAcid

Requested From: United States
Date Requested: 8/10/2020