Products
Services
Research Areas
COVID-19
Resources
Contact Us
Distributors
Login
Quick Order
Cart
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Services
Immunohistochemistry Services

Work with LifeSpan to design a custom immunohistochemistry to address your specific biological question. Outsource the entire localization process without having to worry about finding and characterizing target specific antibodies, sourcing and validating difficult-to-find tissues, and having the ability to interpret the resulting immunostaining in relation to complex human pathologies.

TCR Screening Services

Test your therapeutic antibodies in immunohistochemistry against a broad panel of normal frozen human tissue types in order to determine potential unintended binding. Our non-GLP TCR services are designed on the FDA recommendation outlined in their "Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use".

Research Areas
Cell Cycle Pathways
Protein Family And Group
Infectious Disease
Contact Us
LSBio
2401 Fourth Avenue Suite 900
Seattle WA 98121
Phone:
866-819-4732 (Toll Free North America
206-374-1102 (International)
Fax:
866-206-6909 (Toll Free North America)
206-577-4565 (International)
How To Buy - Details about how to buy our products.
Orders@LSBio.com - To submit a new order.
Customer.Support@LSBio.com - To submit questions about existing orders, pricing, availability, bulk quotes, froforma invoice requests, or other billing issues.
Technical.Support@LSBio.com - To request technical information about an LSBio product or its applications
Sales@LSBio.com - To request information about fee-for-service contract IHC studies, IHC reports, distribution agreements, or general business development.
Worldwide Distributors List - To find your local distributor if you're not within the United States.
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Catalog Number Size Price
LS-N56579-1 1 Each $245 
NPHP1 / Nephronophthisis NucleicAcid

Human NPHP1 / Nephronophthisis Expression-Ready ORF Clone (pCMV3-N-GFP) LS-N56579

Human NPHP1 / Nephronophthisis Expression-Ready ORF Clone (pCMV3-N-GFP) LS-N56579

Description:
Human NPHP1 / Nephronophthisis Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-N-GFP, with N-Terminal GFP tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-N-GFP
Other formats:
Price
Catalog Number
$245 
LS-N56579-1
1 Each

Estimated Shipping: 20 Business Days
Toll Free North America
866-819-4732
For Research Use Only

Overview

Description:
Human NPHP1 / Nephronophthisis Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-N-GFP, with N-Terminal GFP tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-N-GFP
Other formats:

Specifications

Type
Expression-Ready ORF Clone
Target
NPHP1 / Nephronophthisis
Synonyms
NPHP1 | JBTS4 | Nephrocystin 1 | Nephronophthisis | SLSN1 | Nephrocystin-1 | Nephronophthisis 1 (juvenile) | NPH1
Species
Human
Insert Size
1845 bp
Cloning Enzymes Used
This construct is not yet assembled.
Presentation
Lyophilized
Reconstitution
  • Centrifuge at 5,000 x g for 5 minutes.
  • Carefully open the tube and add 100 µl of sterile water to dissolve the DNA.
  • Close the tube and incubate for 10 minutes at room temperature.
  • Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5,000 x g.
  • Store the plasmid at -20°C.
Storage
Store lyophilized at room temperature for up to three months.
Validation
The insert is confirmed by full-length sequencing with the sequencing primers listed.
Restrictions
For research use only. Intended for use by laboratory professionals.
Guarantee
This Expression-Ready ORF Clone carries the LSBio 100% Guarantee.
LSBio Guarantee
Vector
pCMV3-N-GFP
Vector Type
Expression Vector
Vector Information
All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
  • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
  • Hygromycin resistance gene for selection in mammalian cell lines.
  • A Kozak consensus sequence to enhance mammalian expression.
CMV promoter: bp 250-837
Enhancer: bp 838-1445
SV40 early promoter: bp 3029-3398
Hygromycin ORF: bp 3416-4441
pUC origin: bp 5084-5757
Kanamycin ORF: bp 5831-6646
Expression System
Mammalian
Expression Method
Constitutive, Stable/Transient
Promoter
CMV
Sequencing Primers
T7 - 5' TAATACGACTCACTATAGGG 3'
BGH - 5' TAGAAGGCACAGTCGAGG 3'
Vector Size
6788 bp
Vector Sequence
1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTGCACTCT CAGTACAATC 51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT 101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG 151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG 201 CTGCTTCGCG AGTACATTTA TATTGGCTCA TGTCCAATAT GACCGCCATG 251 TTGACATTGA TTATTGACTA GTTATTAATA GTAATCAATT ACGGGGTCAT 301 TAGTTCATAG CCCATATATG GAGTTCCGCG TTACATAACT TACGGTAAAT 351 GGCCCGCCTG GCTGACCGCC CAACGACCCC CGCCCATTGA CGTCAATAAT 401 GACGTATGTT CCCATAGTAA CGCCAATAGG GACTTTCCAT TGACGTCAAT 451 GGGTGGAGTA TTTACGGTAA ACTGCCCACT TGGCAGTACA TCAAGTGTAT 501 CATATGCCAA GTCCGCCCCC TATTGACGTC AATGACGGTA AATGGCCCGC 551 CTGGCATTAT GCCCAGTACA TGACCTTACG GGACTTTCCT ACTTGGCAGT 601 ACATCTACGT ATTAGTCATC GCTATTACCA TGGTGATGCG GTTTTGGCAG 651 TACACCAATG GGCGTGGATA GCGGTTTGAC TCACGGGGAT TTCCAAGTCT 701 CCACCCCATT GACGTCAATG GGAGTTTGTT TTGGCACCAA AATCAACGGG 751 ACTTTCCAAA ATGTCGTAAT AACCCCGCCC CGTTGACGCA AATGGGCGGT 801 AGGCGTGTAC GGTGGGAGGT CTATATAAGC AGAGCTCGTT TAGTGAACCG 851 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTTGG 901 GCTCGCGGTT GAGGACAAAC TCTTCGCGGT CTTTCCAGTA CTCTTGGATC 951 GGAAACCCGT CGGCCTCCGA ACGGTACTCC GCCACCGAGG GACCTGAGCG 1001 AGTCCGCATC GACCGGATCG GAAAACCTCT CGAGAAAGGC GTCTAACCAG 1051 TCACAGTCGC AAGGTAGGCT GAGCACCGTG GCGGGCGGCA GCGGGTGGCG 1101 GTCGGGGTTG TTTCTGGCGG AGGTGCTGCT GATGATGTAA TTAAAGTAGG 1151 CGGTCTTGAG ACGGCGGATG GTCGAGGTGA GGTGTGGGTT TAGTGAACCG 1201 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTCAG 1251 GCTTGAGATC CAGCTGTTGG GGTGAGTACT CCCTCTCAAA AGCGGGCATT 1301 ACTTCTGCGC TAAGATTGTC AGTTTCCAAA AACGAGGAGG ATTTGATATT 1351 CACCTGGCCC GATCTGGCCA TACACTTGAG TGACAATGAC ATCCACTTTG 1401 CCTTTCTCTC CACAGGTGTC CACTCCCAGG TCCAAGTTTA AACTTTAATA 1451 CGACTCACTA TAGGGGCCGC CACCAAGCTT GGTACCATGG TGAGCAAGGG 1501 CGAGGAGCTG TTCACCGGGG TGGTGCCCAT CCTGGTCGAG CTGGACGGCG 1551 ACGTAAACGG CCACAAGTTC AGCGTGTCCG GCGAGGGCGA GGGCGATGCC 1601 ACCTACGGCA AGCTGACCCT GAAGTTCATC TGCACCACCG GCAAGCTGCC 1651 CGTGCCCTGG CCCACCCTCG TGACCACCCT GACCTACGGC GTGCAGTGCT 1701 TCAGCCGCTA CCCCGACCAC ATGAAGAAGC ACGACTTCTT CAAGTCCGCC 1751 ATGCCCGAAG GCTACGTCCA GGAGCGCACC ATCTTCTTCA AGGACGACGG 1801 CAACTACAAG ACCCGCGCCG AGGTGAAGTT CGAGGGCGAC ACCCTGGTGA 1851 ACCGCATCGA GCTGAAGGGC ATCGACTTCA AGGAGGACGG CAACATCCTG 1901 GGGCACAAGC TGGAGTACAA CTACAACAGC CACAACGTCT ATATCATGGC 1951 CGACAAGCAG AAGAACGGCA TCAAGGCTAA CTTCAAGGTT CGCCACAACA 2001 TCGAGGACGG CAGCGTGCAG CTCGCCGACC ACTACCAGCA GAACACCCCC 2051 ATCGGCGACG GCCCCGTGCT GCTGCCCGAC AACCACTACC TGAGCACCCA 2101 GTCCGCCCTG AGCAAAGACC CCAACGAGAA GCGCGATCAC ATGGTCCTGC 2151 TGGAGTTCGT GACCGCCGCC GGGATCACTC TCGGCATGGA CGAGCTGTAC 2201 AAGGGTGGAG GCGGTAGCGC TGCTAGCGGA TCCGTTAACC TTAAGACCGG 2251 TGATATCATC GATTAAACTC GAGTCTAGAG CGGCCGCCGA ATTCGGGCCC 2301 GTTTAAACCC GCTGATCAGC CTCGACTGTG CCTTCTAGTT GCCAGCCATC 2351 TGTTGTTTGC CCCTCCCCCG TGCCTTCCTT GACCCTGGAA GGTGCCACTC 2401 CCACTGTCCT TTCCTAATAA AATGAGGAAA TTGCATCGCA TTGTCTGAGT 2451 AGGTGTCATT CTATTCTGGG GGGTGGGGTG GGGCAGGACA GCAAGGGGGA 2501 GGATTGGGAA GACAATAGCA GGCATGCTGG GGATGCGGTG GGCTCTATGG 2551 CTTCTGAGGC GGAAAGAACC AGCTGGGGCT CTAGGGGGTA TCCCCACGCG 2601 CCCTGTAGCG GCGCATTAAG CGCGGCGGGT GTGGTGGTTA CGCGCAGCGT 2651 GACCGCTACA CTTGCCAGCG CCCTAGCGCC CGCTCCTTTC GCTTTCTTCC 2701 CTTCCTTTCT CGCCACGTTC GCAGGCTTTC CCCGTCAAGC TCTAAATCGG 2751 GGGCTCCCTT TAGGGTTCCG ATTTAGTGCT TTACGGCACC TCGACCCCAA 2801 AAAACTTGAT TAGGGTGATG GTTCACGTAG TGGGCCATCG CCCTGATAGA 2851 CGGTTTTTCG CCCTTTGACG TTGGAGTCCA CGTTCTTTAA TAGTGGACTC 2901 TTGTTCCAAA CTGGAACAAC ACTCAACCCT ATCTCGGTCT ATTCTTTTGA 2951 TTTATAAGGG ATTTTGCCGA TTTCGGCCTA TTGGTTAAAA AATGAGCTGA 3001 TTTAACAAAA ATTTAACGCG AATTAATTCT GTGGAATGTG TGTCAGTTAG 3051 GGTGTGGAAA GTCCCCAGGC TCCCCAGCAG GCAGAAGTAT GCAAAGCATG 3101 CATCTCAATT AGTCAGCAAC CAGGTGTGGA AAGTCCCCAG GCTCCCCAGC 3151 AGGCAGAAGT ATGCAAAGCA TGCATCTCAA TTAGTCAGCA ACCATAGTCC 3201 CGCCCCTAAC TCCGCCCATC CCGCCCCTAA CTCCGCCCAG TTCCGCCCAT 3251 TCTCCGCCCC ATGGCTGACT AATTTTTTTT ATTTATGCAG AGGCCGAGGC 3301 CGCCTCTGCC TCTGAGCTAT TCCAGAAGTA GTGAGGAGGC TTTTTTGGAG 3351 GCCTAGGCTT TTGCAAAAAG CTCTCGGGAG CTTGTATATC CATTTTCGGA 3401 TCTGATCAGC ACGTGATGAA AAAGCCTGAA CTCACCGCGA CGTCTGTCGA 3451 GAAGTTTCTG ATCGAAAAGT TCGACAGCGT CTCCGACCTG ATGCAGCTCT 3501 CGGAGGGCGA AGAATCTCGT GCTTTCAGCT TCGATGTAGG AGGGCGTGGA 3551 TATGTCCTGC GGGTAAATAG CTGCGCCGAT GGTTTCTACA AAGATCGTTA 3601 TGTTTATCGG CACTTTGCAT CGGCCGCGCT CCCGATTCCG GAAGTGCTTG 3651 ACATTGGGGA ATTCAGCGAG AGCCTGACCT ATTGCATCTC CCGCCGTGCA 3701 CAGGGTGTCA CGTTGCAAGA CCTGCCTGAA ACCGAACTGC CCGCTGTTCT 3751 GCAGCCGGTC GCGGAGGCCA TGGATGCGAT CGCTGCGGCC GATCTTAGCC 3801 AGACGAGCGG GTTCGGCCCA TTCGGACCGC AAGGAATCGG TCAATACACT 3851 ACATGGCGTG ATTTCATATG CGCGATTGCT GATCCCCATG TGTATCACTG 3901 GCAAACTGTG ATGGACGACA CCGTCAGTGC GTCCGTCGCG CAGGCTCTCG 3951 ATGAGCTGAT GCTTTGGGCC GAGGACTGCC CCGAAGTCCG GCACCTCGTG 4001 CACGCGGATT TCGGCTCCAA CAATGTCCTG ACGGACAATG GCCGCATAAC 4051 AGCGGTCATT GACTGGAGCG AGGCGATGTT CGGGGATTCC CAATACGAGG 4101 TCGCCAACAT CTTCTTCTGG AGGCCGTGGT TGGCTTGTAT GGAGCAGCAG 4151 ACGCGCTACT TCGAGCGGAG GCATCCGGAG CTTGCAGGAT CGCCGCGGCT 4201 CCGGGCGTAT ATGCTCCGCA TTGGTCTTGA CCAACTCTAT CAGAGCTTGG 4251 TTGACGGCAA TTTCGATGAT GCAGCTTGGG CGCAGGGTCG ATGCGACGCA 4301 ATCGTCCGAT CCGGAGCCGG GACTGTCGGG CGTACACAAA TCGCCCGCAG 4351 AAGCGCGGCC GTCTGGACCG ATGGCTGTGT AGAAGTACTC GCCGATAGTG 4401 GAAACCGACG CCCCAGCACT CGTCCGAGGG CAAAGGAATA GCACGTGCTA 4451 CGAGATTTCG ATTCCACCGC CGCCTTCTAT GAAAGGTTGG GCTTCGGAAT 4501 CGTTTTCCGG GACGCTGGCT GGATGATCCT CCAGCGCGGG GATCTCATGC 4551 TGGAGTTCTT CGCCCACCCC AACTTGTTTA TTGCAGCTTA TAATGGTTAC 4601 AAATAAAGCA ATAGCATCAC AAATTTCACA AATAAAGCAT TTTTTTCACT 4651 GCATTCTAGT TGTGGTTTGT CCAAACTCAT CAATGTATCT TATCATGTCT 4701 GTATACCGTC GACCTCTAGC TAGAGCTTGG CGTAATCATG GTCATAGCTG 4751 TTTCCTGTGT GAAATTGTTA TCCGCTCACA ATTCCACACA ACATACGAGC 4801 CGGAAGCATA AAGTGTAAAG CCTGGGGTGC CTAATGAGTG AGCTAACTCA 4851 CATTAATTGC GTTGCGCTCA CTGCCCGCTT TCCAGTCGGG AAACCTGTCG 4901 TGCCAGCTGC ATTAATGAAT CGGCCAACGC GCGGGGAGAG GCGGTTTGCG 4951 TATTGGGCGC TCTTCCGCTT CCTCGCTCAC TGACTCGCTG CGCTCGGTCG 5001 TTCGGCTGCG GCGAGCGGTA TCAGCTCACT CAAAGGCGGT AATACGGTTA 5051 TCCACAGAAT CAGGGGATAA CGCAGGAAAG AACATGTGAG CAAAAGGCCA 5101 GCAAAAGGCC AGGAACCGTA AAAAGGCCGC GTTGCTGGCG TTTTTCCATA 5151 GGCTCCGCCC CCCTGACGAG CATCACAAAA ATCGACGCTC AAGTCAGAGG 5201 TGGCGAAACC CGACAGGACT ATAAAGATAC CAGGCGTTTC CCCCTGGAAG 5251 CTCCCTCGTG CGCTCTCCTG TTCCGACCCT GCCGCTTACC GGATACCTGT 5301 CCGCCTTTCT CCCTTCGGGA AGCGTGGCGC TTTCTCATAG CTCACGCTGT 5351 AGGTATCTCA GTTCGGTGTA GGTCGTTCGC TCCAAGCTGG GCTGTGTGCA 5401 CGAACCCCCC GTTCAGCCCG ACCGCTGCGC CTTATCCGGT AACTATCGTC 5451 TTGAGTCCAA CCCGGTAAGA CACGACTTAT CGCCACTGGC AGCAGCCACT 5501 GGTAACAGGA TTAGCAGAGC GAGGTATGTA GGCGGTGCTA CAGAGTTCTT 5551 GAAGTGGTGG CCTAACTACG GCTACACTAG AAGAACAGTA TTTGGTATCT 5601 GCGCTCTGCT GAAGCCAGTT ACCTTCGGAA AAAGAGTTGG TAGCTCTTGA 5651 TCCGGCAAAC AAACCACCGC TGGTAGCGGT GGTTTTTTTG TTTGCAAGCA 5701 GCAGATTACG CGCAGAAAAA AAGGATCTCA AGAAGATCCT TTGATCTTTT 5751 CTACGGGGTC TGAGCGCGGA ACCCCTATTT GTTTATTTTT CTAAATACAT 5801 TCAAATATGT ATCCGCTCAT GAATTAATTC TTAGAAAAAC TCATCGAGCA 5851 TCAAATGAAA CTGCAATTTA TTCATATCAG GATTATCAAT ACCATATTTT 5901 TGAAAAAGCC GTTTCTGTAA TGAAGGAGAA AACTCACCGA GGCAGTTCCA 5951 TAGGATGGCA AGATCCTGGT ATCGGTCTGC GATTCCGACT CGTCCAACAT 6001 CAATACAACC TATTAATTTC CCCTCGTCAA AAATAAGGTT ATCAAGTGAG 6051 AAATCACCAT GAGTGACGAC TGAATCCGGT GAGAATGGCA AAAGTTTATG 6101 CATTTCTTTC CAGACTTGTT CAACAGGCCA GCCATTACGC TCGTCATCAA 6151 AATCACTCGC ATCAACCAAA CCGTTATTCA TTCGTGATTG CGCCTGAGCG 6201 AGACGAAATA CGCGATCGCT GTTAAAAGGA CAATTACAAA CAGGAATCGA 6251 ATGCAACCGG CGCAGGAACA CTGCCAGCGC ATCAACAATA TTTTCACCTG 6301 AATCAGGATA TTCTTCTAAT ACCTGGAATG CTGTTTTCCC AGGGATCGCA 6351 GTGGTGAGTA ACCATGCATC ATCAGGAGTA CGGATAAAAT GCTTGATGGT 6401 CGGAAGAGGC ATAAATTCCG TCAGCCAGTT TAGTCTGACC ATCTCATCTG 6451 TAACATCATT GGCAACGCTA CCTTTGCCAT GTTTCAGAAA CAACTCTGGC 6501 GCATCGGGCT TCCCATACAA TCGATAGATT GTCGCACCTG ATTGCCCGAC 6551 ATTATCGCGA GCCCATTTAT ACCCATATAA ATCAGCATCC ATGTTGGAAT 6601 TTAATCGCGG CCTAGAGCAA GACGTTTCCC GTTGAATATG GCTCATAACA 6651 CCCCTTGTAT TACTGTTTAT GTAAGCAGAC AGTTTTATTG TTCATGACCA 6701 AAATCCCTTA ACGTGAGTTT TCGTTCCACT GAGCGTCAGA CCCCGTAGAA 6751 ATCCGCGCAC ATTTCCCCGA AAAGTGCCAC CTGACGTC
Vector Tag
GFP, N-terminus
Tag Information
A GFP-tag (green fluorescent protein) possesses bright green fluorescence (excitation/emission max = 487/508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. The GFP-tag is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is especially recommended for cell and organelle labeling and tracking promoter activity.
Usage Summary
Most commercially available competent cells are appropriate for propagation of the plasmid, e.g. TOP10, DH5a, and TOP10F’.
About NPHP1 / Nephronophthisis
O15259 NM_000272 NP_000263.2

Publications (0)

Customer Reviews (0)

Images

NPHP1 / Nephronophthisis NucleicAcid

NPHP1 / Nephronophthisis NucleicAcid

NPHP1 / Nephronophthisis NucleicAcid

NPHP1 / Nephronophthisis NucleicAcid

Requested From: United States
Date Requested: 8/13/2020