Products
Services
Research Areas
COVID-19
Resources
Contact Us
Distributors
Login
Quick Order
Cart
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Services
Immunohistochemistry Services

Work with LifeSpan to design a custom immunohistochemistry to address your specific biological question. Outsource the entire localization process without having to worry about finding and characterizing target specific antibodies, sourcing and validating difficult-to-find tissues, and having the ability to interpret the resulting immunostaining in relation to complex human pathologies.

TCR Screening Services

Test your therapeutic antibodies in immunohistochemistry against a broad panel of normal frozen human tissue types in order to determine potential unintended binding. Our non-GLP TCR services are designed on the FDA recommendation outlined in their "Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use".

Research Areas
Cell Cycle Pathways
Protein Family And Group
Infectious Disease
Contact Us
LSBio
2401 Fourth Avenue Suite 900
Seattle WA 98121
Phone:
866-819-4732 (Toll Free North America
206-374-1102 (International)
Fax:
866-206-6909 (Toll Free North America)
206-577-4565 (International)
How To Buy - Details about how to buy our products.
Orders@LSBio.com - To submit a new order.
Customer.Support@LSBio.com - To submit questions about existing orders, pricing, availability, bulk quotes, froforma invoice requests, or other billing issues.
Technical.Support@LSBio.com - To request technical information about an LSBio product or its applications
Sales@LSBio.com - To request information about fee-for-service contract IHC studies, IHC reports, distribution agreements, or general business development.
Worldwide Distributors List - To find your local distributor if you're not within the United States.
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Catalog Number Size Price
LS-N55611-1 1 Each $196 
HOXC10 NucleicAcid

Human HOXC10 Expression-Ready ORF Clone (pCMV3-N-DDK (Flag)) LS-N55611

Human HOXC10 Expression-Ready ORF Clone (pCMV3-N-DDK (Flag)) LS-N55611

Description:
Human HOXC10 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-N-DDK (Flag, with N-Terminal DDK (Flag tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-N-DDK (Flag)
Other formats:
Price
Catalog Number
$196 
LS-N55611-1
1 Each

Estimated Shipping: 20 Business Days
Toll Free North America
866-819-4732
For Research Use Only

Overview

Description:
Human HOXC10 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-N-DDK (Flag, with N-Terminal DDK (Flag tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-N-DDK (Flag)
Other formats:

Specifications

Type
Expression-Ready ORF Clone
Target
HOXC10
Synonyms
HOXC10 | Homeobox C10 | Homeobox protein Hox-C10 | Homeobox protein Hox-3I | Homeoprotein C10 | HOX3I | Homeo box C10
Species
Human
Insert Size
1029 bp
Cloning Enzymes Used
This construct is not yet assembled.
Presentation
Lyophilized
Reconstitution
  • Centrifuge at 5,000 x g for 5 minutes.
  • Carefully open the tube and add 100 µl of sterile water to dissolve the DNA.
  • Close the tube and incubate for 10 minutes at room temperature.
  • Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5,000 x g.
  • Store the plasmid at -20°C.
Storage
Store lyophilized at room temperature for up to three months.
Validation
The insert is confirmed by full-length sequencing with the sequencing primers listed.
Restrictions
For research use only. Intended for use by laboratory professionals.
Guarantee
This Expression-Ready ORF Clone carries the LSBio 100% Guarantee.
LSBio Guarantee
Vector
pCMV3-N-DDK (Flag)
Vector Type
Expression Vector
Vector Information
All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
  • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
  • Hygromycin resistance gene for selection in mammalian cell lines.
  • A Kozak consensus sequence to enhance mammalian expression.
This vector is suitable for intracellular protein expression.
CMV promoter: bp 250-837
Enhancer: bp 838-1445
SV40 early promoter: bp 2339-2708
Hygromycin ORF: bp 2726-3751
pUC origin: bp 4394-5067
Kanamycin ORF: bp 5141-5956
Expression System
Mammalian
Expression Method
Constitutive, Stable/Transient
Promoter
CMV
Sequencing Primers
T7 - 5' TAATACGACTCACTATAGGG 3'
BGH - 5' TAGAAGGCACAGTCGAGG 3'
Vector Size
6098 bp
Vector Sequence
1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTGCACTCT CAGTACAATC 51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT 101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG 151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG 201 CTGCTTCGCG AGTACATTTA TATTGGCTCA TGTCCAATAT GACCGCCATG 251 TTGACATTGA TTATTGACTA GTTATTAATA GTAATCAATT ACGGGGTCAT 301 TAGTTCATAG CCCATATATG GAGTTCCGCG TTACATAACT TACGGTAAAT 351 GGCCCGCCTG GCTGACCGCC CAACGACCCC CGCCCATTGA CGTCAATAAT 401 GACGTATGTT CCCATAGTAA CGCCAATAGG GACTTTCCAT TGACGTCAAT 451 GGGTGGAGTA TTTACGGTAA ACTGCCCACT TGGCAGTACA TCAAGTGTAT 501 CATATGCCAA GTCCGCCCCC TATTGACGTC AATGACGGTA AATGGCCCGC 551 CTGGCATTAT GCCCAGTACA TGACCTTACG GGACTTTCCT ACTTGGCAGT 601 ACATCTACGT ATTAGTCATC GCTATTACCA TGGTGATGCG GTTTTGGCAG 651 TACACCAATG GGCGTGGATA GCGGTTTGAC TCACGGGGAT TTCCAAGTCT 701 CCACCCCATT GACGTCAATG GGAGTTTGTT TTGGCACCAA AATCAACGGG 751 ACTTTCCAAA ATGTCGTAAT AACCCCGCCC CGTTGACGCA AATGGGCGGT 801 AGGCGTGTAC GGTGGGAGGT CTATATAAGC AGAGCTCGTT TAGTGAACCG 851 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTTGG 901 GCTCGCGGTT GAGGACAAAC TCTTCGCGGT CTTTCCAGTA CTCTTGGATC 951 GGAAACCCGT CGGCCTCCGA ACGGTACTCC GCCACCGAGG GACCTGAGCG 1001 AGTCCGCATC GACCGGATCG GAAAACCTCT CGAGAAAGGC GTCTAACCAG 1051 TCACAGTCGC AAGGTAGGCT GAGCACCGTG GCGGGCGGCA GCGGGTGGCG 1101 GTCGGGGTTG TTTCTGGCGG AGGTGCTGCT GATGATGTAA TTAAAGTAGG 1151 CGGTCTTGAG ACGGCGGATG GTCGAGGTGA GGTGTGGGTT TAGTGAACCG 1201 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTCAG 1251 GCTTGAGATC CAGCTGTTGG GGTGAGTACT CCCTCTCAAA AGCGGGCATT 1301 ACTTCTGCGC TAAGATTGTC AGTTTCCAAA AACGAGGAGG ATTTGATATT 1351 CACCTGGCCC GATCTGGCCA TACACTTGAG TGACAATGAC ATCCACTTTG 1401 CCTTTCTCTC CACAGGTGTC CACTCCCAGG TCCAAGTTTA AACTTTAATA 1451 CGACTCACTA TAGGGGCCGC CACCAAGCTT GGTACCATGG ATTACAAGGA 1501 TGACGACGAT AAGGGTGGAG GCGGTAGCGC TGCTAGCGGA TCCGTTAACC 1551 TTAAGACCGG TGATATCATC GATTAAACTC GAGTCTAGAG CGGCCGCCGA 1601 ATTCGGGCCC GTTTAAACCC GCTGATCAGC CTCGACTGTG CCTTCTAGTT 1651 GCCAGCCATC TGTTGTTTGC CCCTCCCCCG TGCCTTCCTT GACCCTGGAA 1701 GGTGCCACTC CCACTGTCCT TTCCTAATAA AATGAGGAAA TTGCATCGCA 1751 TTGTCTGAGT AGGTGTCATT CTATTCTGGG GGGTGGGGTG GGGCAGGACA 1801 GCAAGGGGGA GGATTGGGAA GACAATAGCA GGCATGCTGG GGATGCGGTG 1851 GGCTCTATGG CTTCTGAGGC GGAAAGAACC AGCTGGGGCT CTAGGGGGTA 1901 TCCCCACGCG CCCTGTAGCG GCGCATTAAG CGCGGCGGGT GTGGTGGTTA 1951 CGCGCAGCGT GACCGCTACA CTTGCCAGCG CCCTAGCGCC CGCTCCTTTC 2001 GCTTTCTTCC CTTCCTTTCT CGCCACGTTC GCAGGCTTTC CCCGTCAAGC 2051 TCTAAATCGG GGGCTCCCTT TAGGGTTCCG ATTTAGTGCT TTACGGCACC 2101 TCGACCCCAA AAAACTTGAT TAGGGTGATG GTTCACGTAG TGGGCCATCG 2151 CCCTGATAGA CGGTTTTTCG CCCTTTGACG TTGGAGTCCA CGTTCTTTAA 2201 TAGTGGACTC TTGTTCCAAA CTGGAACAAC ACTCAACCCT ATCTCGGTCT 2251 ATTCTTTTGA TTTATAAGGG ATTTTGCCGA TTTCGGCCTA TTGGTTAAAA 2301 AATGAGCTGA TTTAACAAAA ATTTAACGCG AATTAATTCT GTGGAATGTG 2351 TGTCAGTTAG GGTGTGGAAA GTCCCCAGGC TCCCCAGCAG GCAGAAGTAT 2401 GCAAAGCATG CATCTCAATT AGTCAGCAAC CAGGTGTGGA AAGTCCCCAG 2451 GCTCCCCAGC AGGCAGAAGT ATGCAAAGCA TGCATCTCAA TTAGTCAGCA 2501 ACCATAGTCC CGCCCCTAAC TCCGCCCATC CCGCCCCTAA CTCCGCCCAG 2551 TTCCGCCCAT TCTCCGCCCC ATGGCTGACT AATTTTTTTT ATTTATGCAG 2601 AGGCCGAGGC CGCCTCTGCC TCTGAGCTAT TCCAGAAGTA GTGAGGAGGC 2651 TTTTTTGGAG GCCTAGGCTT TTGCAAAAAG CTCTCGGGAG CTTGTATATC 2701 CATTTTCGGA TCTGATCAGC ACGTGATGAA AAAGCCTGAA CTCACCGCGA 2751 CGTCTGTCGA GAAGTTTCTG ATCGAAAAGT TCGACAGCGT CTCCGACCTG 2801 ATGCAGCTCT CGGAGGGCGA AGAATCTCGT GCTTTCAGCT TCGATGTAGG 2851 AGGGCGTGGA TATGTCCTGC GGGTAAATAG CTGCGCCGAT GGTTTCTACA 2901 AAGATCGTTA TGTTTATCGG CACTTTGCAT CGGCCGCGCT CCCGATTCCG 2951 GAAGTGCTTG ACATTGGGGA ATTCAGCGAG AGCCTGACCT ATTGCATCTC 3001 CCGCCGTGCA CAGGGTGTCA CGTTGCAAGA CCTGCCTGAA ACCGAACTGC 3051 CCGCTGTTCT GCAGCCGGTC GCGGAGGCCA TGGATGCGAT CGCTGCGGCC 3101 GATCTTAGCC AGACGAGCGG GTTCGGCCCA TTCGGACCGC AAGGAATCGG 3151 TCAATACACT ACATGGCGTG ATTTCATATG CGCGATTGCT GATCCCCATG 3201 TGTATCACTG GCAAACTGTG ATGGACGACA CCGTCAGTGC GTCCGTCGCG 3251 CAGGCTCTCG ATGAGCTGAT GCTTTGGGCC GAGGACTGCC CCGAAGTCCG 3301 GCACCTCGTG CACGCGGATT TCGGCTCCAA CAATGTCCTG ACGGACAATG 3351 GCCGCATAAC AGCGGTCATT GACTGGAGCG AGGCGATGTT CGGGGATTCC 3401 CAATACGAGG TCGCCAACAT CTTCTTCTGG AGGCCGTGGT TGGCTTGTAT 3451 GGAGCAGCAG ACGCGCTACT TCGAGCGGAG GCATCCGGAG CTTGCAGGAT 3501 CGCCGCGGCT CCGGGCGTAT ATGCTCCGCA TTGGTCTTGA CCAACTCTAT 3551 CAGAGCTTGG TTGACGGCAA TTTCGATGAT GCAGCTTGGG CGCAGGGTCG 3601 ATGCGACGCA ATCGTCCGAT CCGGAGCCGG GACTGTCGGG CGTACACAAA 3651 TCGCCCGCAG AAGCGCGGCC GTCTGGACCG ATGGCTGTGT AGAAGTACTC 3701 GCCGATAGTG GAAACCGACG CCCCAGCACT CGTCCGAGGG CAAAGGAATA 3751 GCACGTGCTA CGAGATTTCG ATTCCACCGC CGCCTTCTAT GAAAGGTTGG 3801 GCTTCGGAAT CGTTTTCCGG GACGCTGGCT GGATGATCCT CCAGCGCGGG 3851 GATCTCATGC TGGAGTTCTT CGCCCACCCC AACTTGTTTA TTGCAGCTTA 3901 TAATGGTTAC AAATAAAGCA ATAGCATCAC AAATTTCACA AATAAAGCAT 3951 TTTTTTCACT GCATTCTAGT TGTGGTTTGT CCAAACTCAT CAATGTATCT 4001 TATCATGTCT GTATACCGTC GACCTCTAGC TAGAGCTTGG CGTAATCATG 4051 GTCATAGCTG TTTCCTGTGT GAAATTGTTA TCCGCTCACA ATTCCACACA 4101 ACATACGAGC CGGAAGCATA AAGTGTAAAG CCTGGGGTGC CTAATGAGTG 4151 AGCTAACTCA CATTAATTGC GTTGCGCTCA CTGCCCGCTT TCCAGTCGGG 4201 AAACCTGTCG TGCCAGCTGC ATTAATGAAT CGGCCAACGC GCGGGGAGAG 4251 GCGGTTTGCG TATTGGGCGC TCTTCCGCTT CCTCGCTCAC TGACTCGCTG 4301 CGCTCGGTCG TTCGGCTGCG GCGAGCGGTA TCAGCTCACT CAAAGGCGGT 4351 AATACGGTTA TCCACAGAAT CAGGGGATAA CGCAGGAAAG AACATGTGAG 4401 CAAAAGGCCA GCAAAAGGCC AGGAACCGTA AAAAGGCCGC GTTGCTGGCG 4451 TTTTTCCATA GGCTCCGCCC CCCTGACGAG CATCACAAAA ATCGACGCTC 4501 AAGTCAGAGG TGGCGAAACC CGACAGGACT ATAAAGATAC CAGGCGTTTC 4551 CCCCTGGAAG CTCCCTCGTG CGCTCTCCTG TTCCGACCCT GCCGCTTACC 4601 GGATACCTGT CCGCCTTTCT CCCTTCGGGA AGCGTGGCGC TTTCTCATAG 4651 CTCACGCTGT AGGTATCTCA GTTCGGTGTA GGTCGTTCGC TCCAAGCTGG 4701 GCTGTGTGCA CGAACCCCCC GTTCAGCCCG ACCGCTGCGC CTTATCCGGT 4751 AACTATCGTC TTGAGTCCAA CCCGGTAAGA CACGACTTAT CGCCACTGGC 4801 AGCAGCCACT GGTAACAGGA TTAGCAGAGC GAGGTATGTA GGCGGTGCTA 4851 CAGAGTTCTT GAAGTGGTGG CCTAACTACG GCTACACTAG AAGAACAGTA 4901 TTTGGTATCT GCGCTCTGCT GAAGCCAGTT ACCTTCGGAA AAAGAGTTGG 4951 TAGCTCTTGA TCCGGCAAAC AAACCACCGC TGGTAGCGGT GGTTTTTTTG 5001 TTTGCAAGCA GCAGATTACG CGCAGAAAAA AAGGATCTCA AGAAGATCCT 5051 TTGATCTTTT CTACGGGGTC TGAGCGCGGA ACCCCTATTT GTTTATTTTT 5101 CTAAATACAT TCAAATATGT ATCCGCTCAT GAATTAATTC TTAGAAAAAC 5151 TCATCGAGCA TCAAATGAAA CTGCAATTTA TTCATATCAG GATTATCAAT 5201 ACCATATTTT TGAAAAAGCC GTTTCTGTAA TGAAGGAGAA AACTCACCGA 5251 GGCAGTTCCA TAGGATGGCA AGATCCTGGT ATCGGTCTGC GATTCCGACT 5301 CGTCCAACAT CAATACAACC TATTAATTTC CCCTCGTCAA AAATAAGGTT 5351 ATCAAGTGAG AAATCACCAT GAGTGACGAC TGAATCCGGT GAGAATGGCA 5401 AAAGTTTATG CATTTCTTTC CAGACTTGTT CAACAGGCCA GCCATTACGC 5451 TCGTCATCAA AATCACTCGC ATCAACCAAA CCGTTATTCA TTCGTGATTG 5501 CGCCTGAGCG AGACGAAATA CGCGATCGCT GTTAAAAGGA CAATTACAAA 5551 CAGGAATCGA ATGCAACCGG CGCAGGAACA CTGCCAGCGC ATCAACAATA 5601 TTTTCACCTG AATCAGGATA TTCTTCTAAT ACCTGGAATG CTGTTTTCCC 5651 AGGGATCGCA GTGGTGAGTA ACCATGCATC ATCAGGAGTA CGGATAAAAT 5701 GCTTGATGGT CGGAAGAGGC ATAAATTCCG TCAGCCAGTT TAGTCTGACC 5751 ATCTCATCTG TAACATCATT GGCAACGCTA CCTTTGCCAT GTTTCAGAAA 5801 CAACTCTGGC GCATCGGGCT TCCCATACAA TCGATAGATT GTCGCACCTG 5851 ATTGCCCGAC ATTATCGCGA GCCCATTTAT ACCCATATAA ATCAGCATCC 5901 ATGTTGGAAT TTAATCGCGG CCTAGAGCAA GACGTTTCCC GTTGAATATG 5951 GCTCATAACA CCCCTTGTAT TACTGTTTAT GTAAGCAGAC AGTTTTATTG 6001 TTCATGACCA AAATCCCTTA ACGTGAGTTT TCGTTCCACT GAGCGTCAGA 6051 CCCCGTAGAA ATCCGCGCAC ATTTCCCCGA AAAGTGCCAC CTGACGTC
Vector Tag
DDK (Flag), N-terminus
Tag Information
DDK (Flag)-tag, or DDK (Flag) octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed proteins from wild-type proteins expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits. A DDK (Flag)-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a DDK (Flag)-tag to this protein allows one to follow the protein with an antibody against the DDK (Flag) sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis. The peptide sequence of the DDK (Flag)-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine-tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g. M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g. M2) are position-insensitive.
Usage Summary
Most commercially available competent cells are appropriate for propagation of the plasmid, e.g. TOP10, DH5a, and TOP10F’.
About HOXC10
Q9NYD6 NM_017409 NP_059105.2

Publications (0)

Customer Reviews (0)

Images

HOXC10 NucleicAcid

HOXC10 NucleicAcid

HOXC10 NucleicAcid

HOXC10 NucleicAcid

Requested From: United States
Date Requested: 8/13/2020