Products
Services
Research Areas
COVID-19
Resources
Contact Us
Distributors
Login
Quick Order
Cart
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Services
Immunohistochemistry Services

Work with LifeSpan to design a custom immunohistochemistry to address your specific biological question. Outsource the entire localization process without having to worry about finding and characterizing target specific antibodies, sourcing and validating difficult-to-find tissues, and having the ability to interpret the resulting immunostaining in relation to complex human pathologies.

TCR Screening Services

Test your therapeutic antibodies in immunohistochemistry against a broad panel of normal frozen human tissue types in order to determine potential unintended binding. Our non-GLP TCR services are designed on the FDA recommendation outlined in their "Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use".

Research Areas
Cell Cycle Pathways
Protein Family And Group
Infectious Disease
Contact Us
LSBio
2401 Fourth Avenue Suite 900
Seattle WA 98121
Phone:
866-819-4732 (Toll Free North America
206-374-1102 (International)
Fax:
866-206-6909 (Toll Free North America)
206-577-4565 (International)
How To Buy - Details about how to buy our products.
Orders@LSBio.com - To submit a new order.
Customer.Support@LSBio.com - To submit questions about existing orders, pricing, availability, bulk quotes, froforma invoice requests, or other billing issues.
Technical.Support@LSBio.com - To request technical information about an LSBio product or its applications
Sales@LSBio.com - To request information about fee-for-service contract IHC studies, IHC reports, distribution agreements, or general business development.
Worldwide Distributors List - To find your local distributor if you're not within the United States.
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Catalog Number Size Price
LS-N55717-1 1 Each $196 
GNRH2 NucleicAcid

Human GNRH2 Expression-Ready ORF Clone (pCMV3-SP-N-His) LS-N55717

Human GNRH2 Expression-Ready ORF Clone (pCMV3-SP-N-His) LS-N55717

Description:
Human GNRH2 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-SP-N-His, with N-Terminal His tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-SP-N-His
Other formats:
Price
Catalog Number
$196 
LS-N55717-1
1 Each

Estimated Shipping: 20 Business Days
Toll Free North America
866-819-4732
For Research Use Only

Overview

Description:
Human GNRH2 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-SP-N-His, with N-Terminal His tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-SP-N-His
Other formats:

Specifications

Type
Expression-Ready ORF Clone
Target
GNRH2
Synonyms
GNRH2 | GnRH-II | LH-RHII | Luliberin II | Progonadoliberin-2 | Progonadoliberin II
Species
Human
Insert Size
363 bp
Cloning Enzymes Used
This construct is not yet assembled.
Presentation
Lyophilized
Reconstitution
  • Centrifuge at 5,000 x g for 5 minutes.
  • Carefully open the tube and add 100 µl of sterile water to dissolve the DNA.
  • Close the tube and incubate for 10 minutes at room temperature.
  • Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5,000 x g.
  • Store the plasmid at -20°C.
Storage
Store lyophilized at room temperature for up to three months.
Validation
The insert is confirmed by full-length sequencing with the sequencing primers listed.
Restrictions
For research use only. Intended for use by laboratory professionals.
Guarantee
This Expression-Ready ORF Clone carries the LSBio 100% Guarantee.
LSBio Guarantee
Vector
pCMV3-SP-N-His
Vector Type
Expression Vector
Vector Information
All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
  • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
  • Hygromycin resistance gene for selection in mammalian cell lines.
  • A Kozak consensus sequence to enhance mammalian expression.
This vector is suitable for secretory and membrane protein expression.
CMV promoter: bp 250-837
Enhancer: bp 838-1445
SV40 early promoter: bp 2390-2759
Hygromycin ORF: bp 2777-3802
pUC origin: bp 4445-5118
Kanamycin ORF: bp 5192-6007
Expression System
Mammalian
Expression Method
Constitutive, Stable/Transient
Promoter
CMV
Sequencing Primers
T7 - 5' TAATACGACTCACTATAGGG 3'
BGH - 5' TAGAAGGCACAGTCGAGG 3'
Vector Size
6149 bp
Vector Sequence
1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTGCACTCT CAGTACAATC 51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT 101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG 151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG 201 CTGCTTCGCG AGTACATTTA TATTGGCTCA TGTCCAATAT GACCGCCATG 251 TTGACATTGA TTATTGACTA GTTATTAATA GTAATCAATT ACGGGGTCAT 301 TAGTTCATAG CCCATATATG GAGTTCCGCG TTACATAACT TACGGTAAAT 351 GGCCCGCCTG GCTGACCGCC CAACGACCCC CGCCCATTGA CGTCAATAAT 401 GACGTATGTT CCCATAGTAA CGCCAATAGG GACTTTCCAT TGACGTCAAT 451 GGGTGGAGTA TTTACGGTAA ACTGCCCACT TGGCAGTACA TCAAGTGTAT 501 CATATGCCAA GTCCGCCCCC TATTGACGTC AATGACGGTA AATGGCCCGC 551 CTGGCATTAT GCCCAGTACA TGACCTTACG GGACTTTCCT ACTTGGCAGT 601 ACATCTACGT ATTAGTCATC GCTATTACCA TGGTGATGCG GTTTTGGCAG 651 TACACCAATG GGCGTGGATA GCGGTTTGAC TCACGGGGAT TTCCAAGTCT 701 CCACCCCATT GACGTCAATG GGAGTTTGTT TTGGCACCAA AATCAACGGG 751 ACTTTCCAAA ATGTCGTAAT AACCCCGCCC CGTTGACGCA AATGGGCGGT 801 AGGCGTGTAC GGTGGGAGGT CTATATAAGC AGAGCTCGTT TAGTGAACCG 851 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTTGG 901 GCTCGCGGTT GAGGACAAAC TCTTCGCGGT CTTTCCAGTA CTCTTGGATC 951 GGAAACCCGT CGGCCTCCGA ACGGTACTCC GCCACCGAGG GACCTGAGCG 1001 AGTCCGCATC GACCGGATCG GAAAACCTCT CGAGAAAGGC GTCTAACCAG 1051 TCACAGTCGC AAGGTAGGCT GAGCACCGTG GCGGGCGGCA GCGGGTGGCG 1101 GTCGGGGTTG TTTCTGGCGG AGGTGCTGCT GATGATGTAA TTAAAGTAGG 1151 CGGTCTTGAG ACGGCGGATG GTCGAGGTGA GGTGTGGGTT TAGTGAACCG 1201 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTCAG 1251 GCTTGAGATC CAGCTGTTGG GGTGAGTACT CCCTCTCAAA AGCGGGCATT 1301 ACTTCTGCGC TAAGATTGTC AGTTTCCAAA AACGAGGAGG ATTTGATATT 1351 CACCTGGCCC GATCTGGCCA TACACTTGAG TGACAATGAC ATCCACTTTG 1401 CCTTTCTCTC CACAGGTGTC CACTCCCAGG TCCAAGTTTA AACTTTAATA 1451 CGACTCACTA TAGGGGCCGC CACCAAGCTT GGTACCATGC CACTGCTGCT 1501 CTTGCTGCCT CTGCTTTGGG CTGGAGCTCT GGCTCACCAT CACCACCATC 1551 ATCACCACCA TCACGGTGGA GGCGGTAGCG CTGCTAGCGG ATCCGTTAAC 1601 CTTAAGACCG GTGATATCAT CGATTAAACT CGAGTCTAGA GCGGCCGCCG 1651 AATTCGGGCC CGTTTAAACC CGCTGATCAG CCTCGACTGT GCCTTCTAGT 1701 TGCCAGCCAT CTGTTGTTTG CCCCTCCCCC GTGCCTTCCT TGACCCTGGA 1751 AGGTGCCACT CCCACTGTCC TTTCCTAATA AAATGAGGAA ATTGCATCGC 1801 ATTGTCTGAG TAGGTGTCAT TCTATTCTGG GGGGTGGGGT GGGGCAGGAC 1851 AGCAAGGGGG AGGATTGGGA AGACAATAGC AGGCATGCTG GGGATGCGGT 1901 GGGCTCTATG GCTTCTGAGG CGGAAAGAAC CAGCTGGGGC TCTAGGGGGT 1951 ATCCCCACGC GCCCTGTAGC GGCGCATTAA GCGCGGCGGG TGTGGTGGTT 2001 ACGCGCAGCG TGACCGCTAC ACTTGCCAGC GCCCTAGCGC CCGCTCCTTT 2051 CGCTTTCTTC CCTTCCTTTC TCGCCACGTT CGCAGGCTTT CCCCGTCAAG 2101 CTCTAAATCG GGGGCTCCCT TTAGGGTTCC GATTTAGTGC TTTACGGCAC 2151 CTCGACCCCA AAAAACTTGA TTAGGGTGAT GGTTCACGTA GTGGGCCATC 2201 GCCCTGATAG ACGGTTTTTC GCCCTTTGAC GTTGGAGTCC ACGTTCTTTA 2251 ATAGTGGACT CTTGTTCCAA ACTGGAACAA CACTCAACCC TATCTCGGTC 2301 TATTCTTTTG ATTTATAAGG GATTTTGCCG ATTTCGGCCT ATTGGTTAAA 2351 AAATGAGCTG ATTTAACAAA AATTTAACGC GAATTAATTC TGTGGAATGT 2401 GTGTCAGTTA GGGTGTGGAA AGTCCCCAGG CTCCCCAGCA GGCAGAAGTA 2451 TGCAAAGCAT GCATCTCAAT TAGTCAGCAA CCAGGTGTGG AAAGTCCCCA 2501 GGCTCCCCAG CAGGCAGAAG TATGCAAAGC ATGCATCTCA ATTAGTCAGC 2551 AACCATAGTC CCGCCCCTAA CTCCGCCCAT CCCGCCCCTA ACTCCGCCCA 2601 GTTCCGCCCA TTCTCCGCCC CATGGCTGAC TAATTTTTTT TATTTATGCA 2651 GAGGCCGAGG CCGCCTCTGC CTCTGAGCTA TTCCAGAAGT AGTGAGGAGG 2701 CTTTTTTGGA GGCCTAGGCT TTTGCAAAAA GCTCTCGGGA GCTTGTATAT 2751 CCATTTTCGG ATCTGATCAG CACGTGATGA AAAAGCCTGA ACTCACCGCG 2801 ACGTCTGTCG AGAAGTTTCT GATCGAAAAG TTCGACAGCG TCTCCGACCT 2851 GATGCAGCTC TCGGAGGGCG AAGAATCTCG TGCTTTCAGC TTCGATGTAG 2901 GAGGGCGTGG ATATGTCCTG CGGGTAAATA GCTGCGCCGA TGGTTTCTAC 2951 AAAGATCGTT ATGTTTATCG GCACTTTGCA TCGGCCGCGC TCCCGATTCC 3001 GGAAGTGCTT GACATTGGGG AATTCAGCGA GAGCCTGACC TATTGCATCT 3051 CCCGCCGTGC ACAGGGTGTC ACGTTGCAAG ACCTGCCTGA AACCGAACTG 3101 CCCGCTGTTC TGCAGCCGGT CGCGGAGGCC ATGGATGCGA TCGCTGCGGC 3151 CGATCTTAGC CAGACGAGCG GGTTCGGCCC ATTCGGACCG CAAGGAATCG 3201 GTCAATACAC TACATGGCGT GATTTCATAT GCGCGATTGC TGATCCCCAT 3251 GTGTATCACT GGCAAACTGT GATGGACGAC ACCGTCAGTG CGTCCGTCGC 3301 GCAGGCTCTC GATGAGCTGA TGCTTTGGGC CGAGGACTGC CCCGAAGTCC 3351 GGCACCTCGT GCACGCGGAT TTCGGCTCCA ACAATGTCCT GACGGACAAT 3401 GGCCGCATAA CAGCGGTCAT TGACTGGAGC GAGGCGATGT TCGGGGATTC 3451 CCAATACGAG GTCGCCAACA TCTTCTTCTG GAGGCCGTGG TTGGCTTGTA 3501 TGGAGCAGCA GACGCGCTAC TTCGAGCGGA GGCATCCGGA GCTTGCAGGA 3551 TCGCCGCGGC TCCGGGCGTA TATGCTCCGC ATTGGTCTTG ACCAACTCTA 3601 TCAGAGCTTG GTTGACGGCA ATTTCGATGA TGCAGCTTGG GCGCAGGGTC 3651 GATGCGACGC AATCGTCCGA TCCGGAGCCG GGACTGTCGG GCGTACACAA 3701 ATCGCCCGCA GAAGCGCGGC CGTCTGGACC GATGGCTGTG TAGAAGTACT 3751 CGCCGATAGT GGAAACCGAC GCCCCAGCAC TCGTCCGAGG GCAAAGGAAT 3801 AGCACGTGCT ACGAGATTTC GATTCCACCG CCGCCTTCTA TGAAAGGTTG 3851 GGCTTCGGAA TCGTTTTCCG GGACGCTGGC TGGATGATCC TCCAGCGCGG 3901 GGATCTCATG CTGGAGTTCT TCGCCCACCC CAACTTGTTT ATTGCAGCTT 3951 ATAATGGTTA CAAATAAAGC AATAGCATCA CAAATTTCAC AAATAAAGCA 4001 TTTTTTTCAC TGCATTCTAG TTGTGGTTTG TCCAAACTCA TCAATGTATC 4051 TTATCATGTC TGTATACCGT CGACCTCTAG CTAGAGCTTG GCGTAATCAT 4101 GGTCATAGCT GTTTCCTGTG TGAAATTGTT ATCCGCTCAC AATTCCACAC 4151 AACATACGAG CCGGAAGCAT AAAGTGTAAA GCCTGGGGTG CCTAATGAGT 4201 GAGCTAACTC ACATTAATTG CGTTGCGCTC ACTGCCCGCT TTCCAGTCGG 4251 GAAACCTGTC GTGCCAGCTG CATTAATGAA TCGGCCAACG CGCGGGGAGA 4301 GGCGGTTTGC GTATTGGGCG CTCTTCCGCT TCCTCGCTCA CTGACTCGCT 4351 GCGCTCGGTC GTTCGGCTGC GGCGAGCGGT ATCAGCTCAC TCAAAGGCGG 4401 TAATACGGTT ATCCACAGAA TCAGGGGATA ACGCAGGAAA GAACATGTGA 4451 GCAAAAGGCC AGCAAAAGGC CAGGAACCGT AAAAAGGCCG CGTTGCTGGC 4501 GTTTTTCCAT AGGCTCCGCC CCCCTGACGA GCATCACAAA AATCGACGCT 4551 CAAGTCAGAG GTGGCGAAAC CCGACAGGAC TATAAAGATA CCAGGCGTTT 4601 CCCCCTGGAA GCTCCCTCGT GCGCTCTCCT GTTCCGACCC TGCCGCTTAC 4651 CGGATACCTG TCCGCCTTTC TCCCTTCGGG AAGCGTGGCG CTTTCTCATA 4701 GCTCACGCTG TAGGTATCTC AGTTCGGTGT AGGTCGTTCG CTCCAAGCTG 4751 GGCTGTGTGC ACGAACCCCC CGTTCAGCCC GACCGCTGCG CCTTATCCGG 4801 TAACTATCGT CTTGAGTCCA ACCCGGTAAG ACACGACTTA TCGCCACTGG 4851 CAGCAGCCAC TGGTAACAGG ATTAGCAGAG CGAGGTATGT AGGCGGTGCT 4901 ACAGAGTTCT TGAAGTGGTG GCCTAACTAC GGCTACACTA GAAGAACAGT 4951 ATTTGGTATC TGCGCTCTGC TGAAGCCAGT TACCTTCGGA AAAAGAGTTG 5001 GTAGCTCTTG ATCCGGCAAA CAAACCACCG CTGGTAGCGG TGGTTTTTTT 5051 GTTTGCAAGC AGCAGATTAC GCGCAGAAAA AAAGGATCTC AAGAAGATCC 5101 TTTGATCTTT TCTACGGGGT CTGAGCGCGG AACCCCTATT TGTTTATTTT 5151 TCTAAATACA TTCAAATATG TATCCGCTCA TGAATTAATT CTTAGAAAAA 5201 CTCATCGAGC ATCAAATGAA ACTGCAATTT ATTCATATCA GGATTATCAA 5251 TACCATATTT TTGAAAAAGC CGTTTCTGTA ATGAAGGAGA AAACTCACCG 5301 AGGCAGTTCC ATAGGATGGC AAGATCCTGG TATCGGTCTG CGATTCCGAC 5351 TCGTCCAACA TCAATACAAC CTATTAATTT CCCCTCGTCA AAAATAAGGT 5401 TATCAAGTGA GAAATCACCA TGAGTGACGA CTGAATCCGG TGAGAATGGC 5451 AAAAGTTTAT GCATTTCTTT CCAGACTTGT TCAACAGGCC AGCCATTACG 5501 CTCGTCATCA AAATCACTCG CATCAACCAA ACCGTTATTC ATTCGTGATT 5551 GCGCCTGAGC GAGACGAAAT ACGCGATCGC TGTTAAAAGG ACAATTACAA 5601 ACAGGAATCG AATGCAACCG GCGCAGGAAC ACTGCCAGCG CATCAACAAT 5651 ATTTTCACCT GAATCAGGAT ATTCTTCTAA TACCTGGAAT GCTGTTTTCC 5701 CAGGGATCGC AGTGGTGAGT AACCATGCAT CATCAGGAGT ACGGATAAAA 5751 TGCTTGATGG TCGGAAGAGG CATAAATTCC GTCAGCCAGT TTAGTCTGAC 5801 CATCTCATCT GTAACATCAT TGGCAACGCT ACCTTTGCCA TGTTTCAGAA 5851 ACAACTCTGG CGCATCGGGC TTCCCATACA ATCGATAGAT TGTCGCACCT 5901 GATTGCCCGA CATTATCGCG AGCCCATTTA TACCCATATA AATCAGCATC 5951 CATGTTGGAA TTTAATCGCG GCCTAGAGCA AGACGTTTCC CGTTGAATAT 6001 GGCTCATAAC ACCCCTTGTA TTACTGTTTA TGTAAGCAGA CAGTTTTATT 6051 GTTCATGACC AAAATCCCTT AACGTGAGTT TTCGTTCCAC TGAGCGTCAG 6101 ACCCCGTAGA AATCCGCGCA CATTTCCCCG AAAAGTGCCA CCTGACGTC
Vector Tag
His, N-terminus
Tag Information
A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein. Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.
Usage Summary
Most commercially available competent cells are appropriate for propagation of the plasmid, e.g. TOP10, DH5a, and TOP10F’.
About GNRH2
O43555 NM_001501 NP_001492.1

Publications (0)

Customer Reviews (0)

Images

GNRH2 NucleicAcid

GNRH2 NucleicAcid

GNRH2 NucleicAcid

GNRH2 NucleicAcid

Requested From: United States
Date Requested: 8/10/2020