Products
Services
Research Areas
COVID-19
Resources
Contact Us
Distributors
Login
Quick Order
Cart
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Services
Immunohistochemistry Services

Work with LifeSpan to design a custom immunohistochemistry to address your specific biological question. Outsource the entire localization process without having to worry about finding and characterizing target specific antibodies, sourcing and validating difficult-to-find tissues, and having the ability to interpret the resulting immunostaining in relation to complex human pathologies.

TCR Screening Services

Test your therapeutic antibodies in immunohistochemistry against a broad panel of normal frozen human tissue types in order to determine potential unintended binding. Our non-GLP TCR services are designed on the FDA recommendation outlined in their "Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use".

Research Areas
Cell Cycle Pathways
Protein Family And Group
Infectious Disease
Contact Us
LSBio
2401 Fourth Avenue Suite 900
Seattle WA 98121
Phone:
866-819-4732 (Toll Free North America
206-374-1102 (International)
Fax:
866-206-6909 (Toll Free North America)
206-577-4565 (International)
How To Buy - Details about how to buy our products.
Orders@LSBio.com - To submit a new order.
Customer.Support@LSBio.com - To submit questions about existing orders, pricing, availability, bulk quotes, froforma invoice requests, or other billing issues.
Technical.Support@LSBio.com - To request technical information about an LSBio product or its applications
Sales@LSBio.com - To request information about fee-for-service contract IHC studies, IHC reports, distribution agreements, or general business development.
Worldwide Distributors List - To find your local distributor if you're not within the United States.
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Catalog Number Size Price
LS-N55536-1 1 Each $225 
GGPS1 NucleicAcid

Human GGPS1 Expression-Ready ORF Clone (pCMV3-C-GFP) LS-N55536

Human GGPS1 Expression-Ready ORF Clone (pCMV3-C-GFP) LS-N55536

Description:
Human GGPS1 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-C-GFP, with C-Terminal GFP tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-C-GFP
Other formats:
Price
Catalog Number
$225 
LS-N55536-1
1 Each

Estimated Shipping: 20 Business Days
Toll Free North America
866-819-4732
For Research Use Only

Overview

Description:
Human GGPS1 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-C-GFP, with C-Terminal GFP tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-C-GFP
Other formats:

Specifications

Type
Expression-Ready ORF Clone
Target
GGPS1
Synonyms
GGPS1 | Dimethylallyltranstransferase | Farnesyl diphosphate synthase | Farnesyltranstransferase | GGPPS1 | Geranyltranstransferase | GGPP synthase | GGPPS | GGPPSase
Species
Human
Insert Size
903 bp
Cloning Enzymes Used
This construct is not yet assembled.
Presentation
Lyophilized
Reconstitution
  • Centrifuge at 5,000 x g for 5 minutes.
  • Carefully open the tube and add 100 µl of sterile water to dissolve the DNA.
  • Close the tube and incubate for 10 minutes at room temperature.
  • Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5,000 x g.
  • Store the plasmid at -20°C.
Storage
Store lyophilized at room temperature for up to three months.
Validation
The insert is confirmed by full-length sequencing with the sequencing primers listed.
Restrictions
For research use only. Intended for use by laboratory professionals.
Guarantee
This Expression-Ready ORF Clone carries the LSBio 100% Guarantee.
LSBio Guarantee
Vector
pCMV3-C-GFP
Vector Type
Expression Vector
Vector Information
All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
  • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
  • Hygromycin resistance gene for selection in mammalian cell lines.
  • A Kozak consensus sequence to enhance mammalian expression.
CMV promoter: bp 250-837
Enhancer: bp 838-1445
SV40 early promoter: bp 3089-3458
Hygromycin ORF: bp 3476-4501
pUC origin: bp 5144-5817
Kanamycin ORF: bp 5891-6706
Expression System
Mammalian
Expression Method
Constitutive, Stable/Transient
Promoter
CMV
Sequencing Primers
T7 - 5' TAATACGACTCACTATAGGG 3'
BGH - 5' TAGAAGGCACAGTCGAGG 3'
Vector Size
6848 bp
Vector Sequence
1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTGCACTCT CAGTACAATC 51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT 101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG 151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG 201 CTGCTTCGCG AGTACATTTA TATTGGCTCA TGTCCAATAT GACCGCCATG 251 TTGACATTGA TTATTGACTA GTTATTAATA GTAATCAATT ACGGGGTCAT 301 TAGTTCATAG CCCATATATG GAGTTCCGCG TTACATAACT TACGGTAAAT 351 GGCCCGCCTG GCTGACCGCC CAACGACCCC CGCCCATTGA CGTCAATAAT 401 GACGTATGTT CCCATAGTAA CGCCAATAGG GACTTTCCAT TGACGTCAAT 451 GGGTGGAGTA TTTACGGTAA ACTGCCCACT TGGCAGTACA TCAAGTGTAT 501 CATATGCCAA GTCCGCCCCC TATTGACGTC AATGACGGTA AATGGCCCGC 551 CTGGCATTAT GCCCAGTACA TGACCTTACG GGACTTTCCT ACTTGGCAGT 601 ACATCTACGT ATTAGTCATC GCTATTACCA TGGTGATGCG GTTTTGGCAG 651 TACACCAATG GGCGTGGATA GCGGTTTGAC TCACGGGGAT TTCCAAGTCT 701 CCACCCCATT GACGTCAATG GGAGTTTGTT TTGGCACCAA AATCAACGGG 751 ACTTTCCAAA ATGTCGTAAT AACCCCGCCC CGTTGACGCA AATGGGCGGT 801 AGGCGTGTAC GGTGGGAGGT CTATATAAGC AGAGCTCGTT TAGTGAACCG 851 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTTGG 901 GCTCGCGGTT GAGGACAAAC TCTTCGCGGT CTTTCCAGTA CTCTTGGATC 951 GGAAACCCGT CGGCCTCCGA ACGGTACTCC GCCACCGAGG GACCTGAGCG 1001 AGTCCGCATC GACCGGATCG GAAAACCTCT CGAGAAAGGC GTCTAACCAG 1051 TCACAGTCGC AAGGTAGGCT GAGCACCGTG GCGGGCGGCA GCGGGTGGCG 1101 GTCGGGGTTG TTTCTGGCGG AGGTGCTGCT GATGATGTAA TTAAAGTAGG 1151 CGGTCTTGAG ACGGCGGATG GTCGAGGTGA GGTGTGGGTT TAGTGAACCG 1201 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTCAG 1251 GCTTGAGATC CAGCTGTTGG GGTGAGTACT CCCTCTCAAA AGCGGGCATT 1301 ACTTCTGCGC TAAGATTGTC AGTTTCCAAA AACGAGGAGG ATTTGATATT 1351 CACCTGGCCC GATCTGGCCA TACACTTGAG TGACAATGAC ATCCACTTTG 1401 CCTTTCTCTC CACAGGTGTC CACTCCCAGG TCCAAGTTTA AACTTTAATA 1451 CGACTCACTA TAGGGGCCGC CACCAAGCTT GGTACCGCTA GCGGATCCGT 1501 TAACCTTAAG ACCGGTATGG GCTGGTCCTG CATCATCCTG TTCCTCGTGG 1551 CGACCGCGAC CGGGGTCCAC AGCGATATCA TCGATAGCGC TCCCGGGGGT 1601 GGAGGCTCTG TGAGCAAGGG CGAGGAGCTG TTCACCGGGG TGGTGCCCAT 1651 CCTGGTCGAG CTGGACGGCG ACGTAAACGG CCACAAGTTC AGCGTGTCCG 1701 GCGAGGGCGA GGGCGATGCC ACCTACGGCA AGCTGACCCT GAAGTTCATC 1751 TGCACCACCG GCAAGCTGCC CGTGCCCTGG CCCACCCTCG TGACCACCCT 1801 GACCTACGGC GTGCAGTGCT TCAGCCGCTA CCCCGACCAC ATGAAGAAGC 1851 ACGACTTCTT CAAGTCCGCC ATGCCCGAAG GCTACGTCCA GGAGCGCACC 1901 ATCTTCTTCA AGGACGACGG CAACTACAAG ACCCGCGCCG AGGTGAAGTT 1951 CGAGGGCGAC ACCCTGGTGA ACCGCATCGA GCTGAAGGGC ATCGACTTCA 2001 AGGAGGACGG CAACATCCTG GGGCACAAGC TGGAGTACAA CTACAACAGC 2051 CACAACGTCT ATATCATGGC CGACAAGCAG AAGAACGGCA TCAAGGCTAA 2101 CTTCAAGGTT CGCCACAACA TCGAGGACGG CAGCGTGCAG CTCGCCGACC 2151 ACTACCAGCA GAACACCCCC ATCGGCGACG GCCCCGTGCT GCTGCCCGAC 2201 AACCACTACC TGAGCACCCA GTCCGCCCTG AGCAAAGACC CCAACGAGAA 2251 GCGCGATCAC ATGGTCCTGC TGGAGTTCGT GACCGCCGCC GGGATCACTC 2301 TCGGCATGGA CGAGCTGTAC AAGTAAACTC GAGTCTAGAG CGGCCGCCGA 2351 ATTCGGGCCC GTTTAAACCC GCTGATCAGC CTCGACTGTG CCTTCTAGTT 2401 GCCAGCCATC TGTTGTTTGC CCCTCCCCCG TGCCTTCCTT GACCCTGGAA 2451 GGTGCCACTC CCACTGTCCT TTCCTAATAA AATGAGGAAA TTGCATCGCA 2501 TTGTCTGAGT AGGTGTCATT CTATTCTGGG GGGTGGGGTG GGGCAGGACA 2551 GCAAGGGGGA GGATTGGGAA GACAATAGCA GGCATGCTGG GGATGCGGTG 2601 GGCTCTATGG CTTCTGAGGC GGAAAGAACC AGCTGGGGCT CTAGGGGGTA 2651 TCCCCACGCG CCCTGTAGCG GCGCATTAAG CGCGGCGGGT GTGGTGGTTA 2701 CGCGCAGCGT GACCGCTACA CTTGCCAGCG CCCTAGCGCC CGCTCCTTTC 2751 GCTTTCTTCC CTTCCTTTCT CGCCACGTTC GCAGGCTTTC CCCGTCAAGC 2801 TCTAAATCGG GGGCTCCCTT TAGGGTTCCG ATTTAGTGCT TTACGGCACC 2851 TCGACCCCAA AAAACTTGAT TAGGGTGATG GTTCACGTAG TGGGCCATCG 2901 CCCTGATAGA CGGTTTTTCG CCCTTTGACG TTGGAGTCCA CGTTCTTTAA 2951 TAGTGGACTC TTGTTCCAAA CTGGAACAAC ACTCAACCCT ATCTCGGTCT 3001 ATTCTTTTGA TTTATAAGGG ATTTTGCCGA TTTCGGCCTA TTGGTTAAAA 3051 AATGAGCTGA TTTAACAAAA ATTTAACGCG AATTAATTCT GTGGAATGTG 3101 TGTCAGTTAG GGTGTGGAAA GTCCCCAGGC TCCCCAGCAG GCAGAAGTAT 3151 GCAAAGCATG CATCTCAATT AGTCAGCAAC CAGGTGTGGA AAGTCCCCAG 3201 GCTCCCCAGC AGGCAGAAGT ATGCAAAGCA TGCATCTCAA TTAGTCAGCA 3251 ACCATAGTCC CGCCCCTAAC TCCGCCCATC CCGCCCCTAA CTCCGCCCAG 3301 TTCCGCCCAT TCTCCGCCCC ATGGCTGACT AATTTTTTTT ATTTATGCAG 3351 AGGCCGAGGC CGCCTCTGCC TCTGAGCTAT TCCAGAAGTA GTGAGGAGGC 3401 TTTTTTGGAG GCCTAGGCTT TTGCAAAAAG CTCTCGGGAG CTTGTATATC 3451 CATTTTCGGA TCTGATCAGC ACGTGATGAA AAAGCCTGAA CTCACCGCGA 3501 CGTCTGTCGA GAAGTTTCTG ATCGAAAAGT TCGACAGCGT CTCCGACCTG 3551 ATGCAGCTCT CGGAGGGCGA AGAATCTCGT GCTTTCAGCT TCGATGTAGG 3601 AGGGCGTGGA TATGTCCTGC GGGTAAATAG CTGCGCCGAT GGTTTCTACA 3651 AAGATCGTTA TGTTTATCGG CACTTTGCAT CGGCCGCGCT CCCGATTCCG 3701 GAAGTGCTTG ACATTGGGGA ATTCAGCGAG AGCCTGACCT ATTGCATCTC 3751 CCGCCGTGCA CAGGGTGTCA CGTTGCAAGA CCTGCCTGAA ACCGAACTGC 3801 CCGCTGTTCT GCAGCCGGTC GCGGAGGCCA TGGATGCGAT CGCTGCGGCC 3851 GATCTTAGCC AGACGAGCGG GTTCGGCCCA TTCGGACCGC AAGGAATCGG 3901 TCAATACACT ACATGGCGTG ATTTCATATG CGCGATTGCT GATCCCCATG 3951 TGTATCACTG GCAAACTGTG ATGGACGACA CCGTCAGTGC GTCCGTCGCG 4001 CAGGCTCTCG ATGAGCTGAT GCTTTGGGCC GAGGACTGCC CCGAAGTCCG 4051 GCACCTCGTG CACGCGGATT TCGGCTCCAA CAATGTCCTG ACGGACAATG 4101 GCCGCATAAC AGCGGTCATT GACTGGAGCG AGGCGATGTT CGGGGATTCC 4151 CAATACGAGG TCGCCAACAT CTTCTTCTGG AGGCCGTGGT TGGCTTGTAT 4201 GGAGCAGCAG ACGCGCTACT TCGAGCGGAG GCATCCGGAG CTTGCAGGAT 4251 CGCCGCGGCT CCGGGCGTAT ATGCTCCGCA TTGGTCTTGA CCAACTCTAT 4301 CAGAGCTTGG TTGACGGCAA TTTCGATGAT GCAGCTTGGG CGCAGGGTCG 4351 ATGCGACGCA ATCGTCCGAT CCGGAGCCGG GACTGTCGGG CGTACACAAA 4401 TCGCCCGCAG AAGCGCGGCC GTCTGGACCG ATGGCTGTGT AGAAGTACTC 4451 GCCGATAGTG GAAACCGACG CCCCAGCACT CGTCCGAGGG CAAAGGAATA 4501 GCACGTGCTA CGAGATTTCG ATTCCACCGC CGCCTTCTAT GAAAGGTTGG 4551 GCTTCGGAAT CGTTTTCCGG GACGCTGGCT GGATGATCCT CCAGCGCGGG 4601 GATCTCATGC TGGAGTTCTT CGCCCACCCC AACTTGTTTA TTGCAGCTTA 4651 TAATGGTTAC AAATAAAGCA ATAGCATCAC AAATTTCACA AATAAAGCAT 4701 TTTTTTCACT GCATTCTAGT TGTGGTTTGT CCAAACTCAT CAATGTATCT 4751 TATCATGTCT GTATACCGTC GACCTCTAGC TAGAGCTTGG CGTAATCATG 4801 GTCATAGCTG TTTCCTGTGT GAAATTGTTA TCCGCTCACA ATTCCACACA 4851 ACATACGAGC CGGAAGCATA AAGTGTAAAG CCTGGGGTGC CTAATGAGTG 4901 AGCTAACTCA CATTAATTGC GTTGCGCTCA CTGCCCGCTT TCCAGTCGGG 4951 AAACCTGTCG TGCCAGCTGC ATTAATGAAT CGGCCAACGC GCGGGGAGAG 5001 GCGGTTTGCG TATTGGGCGC TCTTCCGCTT CCTCGCTCAC TGACTCGCTG 5051 CGCTCGGTCG TTCGGCTGCG GCGAGCGGTA TCAGCTCACT CAAAGGCGGT 5101 AATACGGTTA TCCACAGAAT CAGGGGATAA CGCAGGAAAG AACATGTGAG 5151 CAAAAGGCCA GCAAAAGGCC AGGAACCGTA AAAAGGCCGC GTTGCTGGCG 5201 TTTTTCCATA GGCTCCGCCC CCCTGACGAG CATCACAAAA ATCGACGCTC 5251 AAGTCAGAGG TGGCGAAACC CGACAGGACT ATAAAGATAC CAGGCGTTTC 5301 CCCCTGGAAG CTCCCTCGTG CGCTCTCCTG TTCCGACCCT GCCGCTTACC 5351 GGATACCTGT CCGCCTTTCT CCCTTCGGGA AGCGTGGCGC TTTCTCATAG 5401 CTCACGCTGT AGGTATCTCA GTTCGGTGTA GGTCGTTCGC TCCAAGCTGG 5451 GCTGTGTGCA CGAACCCCCC GTTCAGCCCG ACCGCTGCGC CTTATCCGGT 5501 AACTATCGTC TTGAGTCCAA CCCGGTAAGA CACGACTTAT CGCCACTGGC 5551 AGCAGCCACT GGTAACAGGA TTAGCAGAGC GAGGTATGTA GGCGGTGCTA 5601 CAGAGTTCTT GAAGTGGTGG CCTAACTACG GCTACACTAG AAGAACAGTA 5651 TTTGGTATCT GCGCTCTGCT GAAGCCAGTT ACCTTCGGAA AAAGAGTTGG 5701 TAGCTCTTGA TCCGGCAAAC AAACCACCGC TGGTAGCGGT GGTTTTTTTG 5751 TTTGCAAGCA GCAGATTACG CGCAGAAAAA AAGGATCTCA AGAAGATCCT 5801 TTGATCTTTT CTACGGGGTC TGAGCGCGGA ACCCCTATTT GTTTATTTTT 5851 CTAAATACAT TCAAATATGT ATCCGCTCAT GAATTAATTC TTAGAAAAAC 5901 TCATCGAGCA TCAAATGAAA CTGCAATTTA TTCATATCAG GATTATCAAT 5951 ACCATATTTT TGAAAAAGCC GTTTCTGTAA TGAAGGAGAA AACTCACCGA 6001 GGCAGTTCCA TAGGATGGCA AGATCCTGGT ATCGGTCTGC GATTCCGACT 6051 CGTCCAACAT CAATACAACC TATTAATTTC CCCTCGTCAA AAATAAGGTT 6101 ATCAAGTGAG AAATCACCAT GAGTGACGAC TGAATCCGGT GAGAATGGCA 6151 AAAGTTTATG CATTTCTTTC CAGACTTGTT CAACAGGCCA GCCATTACGC 6201 TCGTCATCAA AATCACTCGC ATCAACCAAA CCGTTATTCA TTCGTGATTG 6251 CGCCTGAGCG AGACGAAATA CGCGATCGCT GTTAAAAGGA CAATTACAAA 6301 CAGGAATCGA ATGCAACCGG CGCAGGAACA CTGCCAGCGC ATCAACAATA 6351 TTTTCACCTG AATCAGGATA TTCTTCTAAT ACCTGGAATG CTGTTTTCCC 6401 AGGGATCGCA GTGGTGAGTA ACCATGCATC ATCAGGAGTA CGGATAAAAT 6451 GCTTGATGGT CGGAAGAGGC ATAAATTCCG TCAGCCAGTT TAGTCTGACC 6501 ATCTCATCTG TAACATCATT GGCAACGCTA CCTTTGCCAT GTTTCAGAAA 6551 CAACTCTGGC GCATCGGGCT TCCCATACAA TCGATAGATT GTCGCACCTG 6601 ATTGCCCGAC ATTATCGCGA GCCCATTTAT ACCCATATAA ATCAGCATCC 6651 ATGTTGGAAT TTAATCGCGG CCTAGAGCAA GACGTTTCCC GTTGAATATG 6701 GCTCATAACA CCCCTTGTAT TACTGTTTAT GTAAGCAGAC AGTTTTATTG 6751 TTCATGACCA AAATCCCTTA ACGTGAGTTT TCGTTCCACT GAGCGTCAGA 6801 CCCCGTAGAA ATCCGCGCAC ATTTCCCCGA AAAGTGCCAC CTGACGTC
Vector Tag
GFP, C-terminus
Tag Information
A GFP-tag (green fluorescent protein) possesses bright green fluorescence (excitation/emission max = 487/508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. The GFP-tag is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is especially recommended for cell and organelle labeling and tracking promoter activity.
Usage Summary
Most commercially available competent cells are appropriate for propagation of the plasmid, e.g. TOP10, DH5a, and TOP10F’.
About GGPS1
O95749 NM_004837 NP_004828.1

Publications (0)

Customer Reviews (0)

Images

GGPS1 NucleicAcid

GGPS1 NucleicAcid

GGPS1 NucleicAcid

GGPS1 NucleicAcid

Requested From: United States
Date Requested: 8/6/2020