Products
Services
Research Areas
COVID-19
Resources
Contact Us
Distributors
Login
Quick Order
Cart
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Services
Immunohistochemistry Services

Work with LifeSpan to design a custom immunohistochemistry to address your specific biological question. Outsource the entire localization process without having to worry about finding and characterizing target specific antibodies, sourcing and validating difficult-to-find tissues, and having the ability to interpret the resulting immunostaining in relation to complex human pathologies.

TCR Screening Services

Test your therapeutic antibodies in immunohistochemistry against a broad panel of normal frozen human tissue types in order to determine potential unintended binding. Our non-GLP TCR services are designed on the FDA recommendation outlined in their "Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use".

Research Areas
Cell Cycle Pathways
Protein Family And Group
Infectious Disease
Contact Us
LSBio
2401 Fourth Avenue Suite 900
Seattle WA 98121
Phone:
866-819-4732 (Toll Free North America
206-374-1102 (International)
Fax:
866-206-6909 (Toll Free North America)
206-577-4565 (International)
How To Buy - Details about how to buy our products.
Orders@LSBio.com - To submit a new order.
Customer.Support@LSBio.com - To submit questions about existing orders, pricing, availability, bulk quotes, froforma invoice requests, or other billing issues.
Technical.Support@LSBio.com - To request technical information about an LSBio product or its applications
Sales@LSBio.com - To request information about fee-for-service contract IHC studies, IHC reports, distribution agreements, or general business development.
Worldwide Distributors List - To find your local distributor if you're not within the United States.
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Catalog Number Size Price
LS-N55463-1 1 Each $196 
CTDNEP1 / DULLARD NucleicAcid

Human CTDNEP1 / DULLARD Expression-Ready ORF Clone (pCMV3-SP-N-HA) LS-N55463

Human CTDNEP1 / DULLARD Expression-Ready ORF Clone (pCMV3-SP-N-HA) LS-N55463

Description:
Human CTDNEP1 / DULLARD Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-SP-N-HA, with N-Terminal HA tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-SP-N-HA
Other formats:
Price
Catalog Number
$196 
LS-N55463-1
1 Each

Estimated Shipping: 20 Business Days
Toll Free North America
866-819-4732
For Research Use Only

Overview

Description:
Human CTDNEP1 / DULLARD Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-SP-N-HA, with N-Terminal HA tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-SP-N-HA
Other formats:

Specifications

Type
Expression-Ready ORF Clone
Target
CTDNEP1 / DULLARD
Synonyms
CTDNEP1 | DULLARD | Dullard homolog | NET56 | HSA011916
Species
Human
Insert Size
735 bp
Cloning Enzymes Used
This construct is not yet assembled.
Presentation
Lyophilized
Reconstitution
  • Centrifuge at 5,000 x g for 5 minutes.
  • Carefully open the tube and add 100 µl of sterile water to dissolve the DNA.
  • Close the tube and incubate for 10 minutes at room temperature.
  • Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5,000 x g.
  • Store the plasmid at -20°C.
Storage
Store lyophilized at room temperature for up to three months.
Validation
The insert is confirmed by full-length sequencing with the sequencing primers listed.
Restrictions
For research use only. Intended for use by laboratory professionals.
Guarantee
This Expression-Ready ORF Clone carries the LSBio 100% Guarantee.
LSBio Guarantee
Vector
pCMV3-SP-N-HA
Vector Type
Expression Vector
Vector Information
All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
  • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
  • Hygromycin resistance gene for selection in mammalian cell lines.
  • A Kozak consensus sequence to enhance mammalian expression.
This vector is suitable for secretory and membrane protein expression.
CMV promoter: bp 250-837
Enhancer: bp 838-1445
SV40 early promoter: bp 2387-2756
Hygromycin ORF: bp 2774-3799
pUC origin: bp 4442-5115
Expression System
Mammalian
Expression Method
Constitutive, Stable/Transient
Promoter
CMV
Sequencing Primers
T7 - 5' TAATACGACTCACTATAGGG 3'
BGH - 5' TAGAAGGCACAGTCGAGG 3'
Vector Size
6146 bp
Vector Sequence
1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTGCACTCT CAGTACAATC 51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT 101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG 151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG 201 CTGCTTCGCG AGTACATTTA TATTGGCTCA TGTCCAATAT GACCGCCATG 251 TTGACATTGA TTATTGACTA GTTATTAATA GTAATCAATT ACGGGGTCAT 301 TAGTTCATAG CCCATATATG GAGTTCCGCG TTACATAACT TACGGTAAAT 351 GGCCCGCCTG GCTGACCGCC CAACGACCCC CGCCCATTGA CGTCAATAAT 401 GACGTATGTT CCCATAGTAA CGCCAATAGG GACTTTCCAT TGACGTCAAT 451 GGGTGGAGTA TTTACGGTAA ACTGCCCACT TGGCAGTACA TCAAGTGTAT 501 CATATGCCAA GTCCGCCCCC TATTGACGTC AATGACGGTA AATGGCCCGC 551 CTGGCATTAT GCCCAGTACA TGACCTTACG GGACTTTCCT ACTTGGCAGT 601 ACATCTACGT ATTAGTCATC GCTATTACCA TGGTGATGCG GTTTTGGCAG 651 TACACCAATG GGCGTGGATA GCGGTTTGAC TCACGGGGAT TTCCAAGTCT 701 CCACCCCATT GACGTCAATG GGAGTTTGTT TTGGCACCAA AATCAACGGG 751 ACTTTCCAAA ATGTCGTAAT AACCCCGCCC CGTTGACGCA AATGGGCGGT 801 AGGCGTGTAC GGTGGGAGGT CTATATAAGC AGAGCTCGTT TAGTGAACCG 851 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTTGG 901 GCTCGCGGTT GAGGACAAAC TCTTCGCGGT CTTTCCAGTA CTCTTGGATC 951 GGAAACCCGT CGGCCTCCGA ACGGTACTCC GCCACCGAGG GACCTGAGCG 1001 AGTCCGCATC GACCGGATCG GAAAACCTCT CGAGAAAGGC GTCTAACCAG 1051 TCACAGTCGC AAGGTAGGCT GAGCACCGTG GCGGGCGGCA GCGGGTGGCG 1101 GTCGGGGTTG TTTCTGGCGG AGGTGCTGCT GATGATGTAA TTAAAGTAGG 1151 CGGTCTTGAG ACGGCGGATG GTCGAGGTGA GGTGTGGGTT TAGTGAACCG 1201 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTCAG 1251 GCTTGAGATC CAGCTGTTGG GGTGAGTACT CCCTCTCAAA AGCGGGCATT 1301 ACTTCTGCGC TAAGATTGTC AGTTTCCAAA AACGAGGAGG ATTTGATATT 1351 CACCTGGCCC GATCTGGCCA TACACTTGAG TGACAATGAC ATCCACTTTG 1401 CCTTTCTCTC CACAGGTGTC CACTCCCAGG TCCAAGTTTA AACTTTAATA 1451 CGACTCACTA TAGGGGCCGC CACCAAGCTT GGTACCATGC CACTGCTGCT 1501 CTTGCTGCCT CTGCTTTGGG CTGGAGCTCT GGCTTATCCT TACGACGTGC 1551 CTGACTACGC CGGTGGAGGC GGTAGCGCTG CTAGCGGATC CGTTAACCTT 1601 AAGACCGGTG ATATCATCGA TTAAACTCGA GTCTAGAGCG GCCGCCGAAT 1651 TCGGGCCCGT TTAAACCCGC TGATCAGCCT CGACTGTGCC TTCTAGTTGC 1701 CAGCCATCTG TTGTTTGCCC CTCCCCCGTG CCTTCCTTGA CCCTGGAAGG 1751 TGCCACTCCC ACTGTCCTTT CCTAATAAAA TGAGGAAATT GCATCGCATT 1801 GTCTGAGTAG GTGTCATTCT ATTCTGGGGG GTGGGGTGGG GCAGGACAGC 1851 AAGGGGGAGG ATTGGGAAGA CAATAGCAGG CATGCTGGGG ATGCGGTGGG 1901 CTCTATGGCT TCTGAGGCGG AAAGAACCAG CTGGGGCTCT AGGGGGTATC 1951 CCCACGCGCC CTGTAGCGGC GCATTAAGCG CGGCGGGTGT GGTGGTTACG 2001 CGCAGCGTGA CCGCTACACT TGCCAGCGCC CTAGCGCCCG CTCCTTTCGC 2051 TTTCTTCCCT TCCTTTCTCG CCACGTTCGC AGGCTTTCCC CGTCAAGCTC 2101 TAAATCGGGG GCTCCCTTTA GGGTTCCGAT TTAGTGCTTT ACGGCACCTC 2151 GACCCCAAAA AACTTGATTA GGGTGATGGT TCACGTAGTG GGCCATCGCC 2201 CTGATAGACG GTTTTTCGCC CTTTGACGTT GGAGTCCACG TTCTTTAATA 2251 GTGGACTCTT GTTCCAAACT GGAACAACAC TCAACCCTAT CTCGGTCTAT 2301 TCTTTTGATT TATAAGGGAT TTTGCCGATT TCGGCCTATT GGTTAAAAAA 2351 TGAGCTGATT TAACAAAAAT TTAACGCGAA TTAATTCTGT GGAATGTGTG 2401 TCAGTTAGGG TGTGGAAAGT CCCCAGGCTC CCCAGCAGGC AGAAGTATGC 2451 AAAGCATGCA TCTCAATTAG TCAGCAACCA GGTGTGGAAA GTCCCCAGGC 2501 TCCCCAGCAG GCAGAAGTAT GCAAAGCATG CATCTCAATT AGTCAGCAAC 2551 CATAGTCCCG CCCCTAACTC CGCCCATCCC GCCCCTAACT CCGCCCAGTT 2601 CCGCCCATTC TCCGCCCCAT GGCTGACTAA TTTTTTTTAT TTATGCAGAG 2651 GCCGAGGCCG CCTCTGCCTC TGAGCTATTC CAGAAGTAGT GAGGAGGCTT 2701 TTTTGGAGGC CTAGGCTTTT GCAAAAAGCT CTCGGGAGCT TGTATATCCA 2751 TTTTCGGATC TGATCAGCAC GTGATGAAAA AGCCTGAACT CACCGCGACG 2801 TCTGTCGAGA AGTTTCTGAT CGAAAAGTTC GACAGCGTCT CCGACCTGAT 2851 GCAGCTCTCG GAGGGCGAAG AATCTCGTGC TTTCAGCTTC GATGTAGGAG 2901 GGCGTGGATA TGTCCTGCGG GTAAATAGCT GCGCCGATGG TTTCTACAAA 2951 GATCGTTATG TTTATCGGCA CTTTGCATCG GCCGCGCTCC CGATTCCGGA 3001 AGTGCTTGAC ATTGGGGAAT TCAGCGAGAG CCTGACCTAT TGCATCTCCC 3051 GCCGTGCACA GGGTGTCACG TTGCAAGACC TGCCTGAAAC CGAACTGCCC 3101 GCTGTTCTGC AGCCGGTCGC GGAGGCCATG GATGCGATCG CTGCGGCCGA 3151 TCTTAGCCAG ACGAGCGGGT TCGGCCCATT CGGACCGCAA GGAATCGGTC 3201 AATACACTAC ATGGCGTGAT TTCATATGCG CGATTGCTGA TCCCCATGTG 3251 TATCACTGGC AAACTGTGAT GGACGACACC GTCAGTGCGT CCGTCGCGCA 3301 GGCTCTCGAT GAGCTGATGC TTTGGGCCGA GGACTGCCCC GAAGTCCGGC 3351 ACCTCGTGCA CGCGGATTTC GGCTCCAACA ATGTCCTGAC GGACAATGGC 3401 CGCATAACAG CGGTCATTGA CTGGAGCGAG GCGATGTTCG GGGATTCCCA 3451 ATACGAGGTC GCCAACATCT TCTTCTGGAG GCCGTGGTTG GCTTGTATGG 3501 AGCAGCAGAC GCGCTACTTC GAGCGGAGGC ATCCGGAGCT TGCAGGATCG 3551 CCGCGGCTCC GGGCGTATAT GCTCCGCATT GGTCTTGACC AACTCTATCA 3601 GAGCTTGGTT GACGGCAATT TCGATGATGC AGCTTGGGCG CAGGGTCGAT 3651 GCGACGCAAT CGTCCGATCC GGAGCCGGGA CTGTCGGGCG TACACAAATC 3701 GCCCGCAGAA GCGCGGCCGT CTGGACCGAT GGCTGTGTAG AAGTACTCGC 3751 CGATAGTGGA AACCGACGCC CCAGCACTCG TCCGAGGGCA AAGGAATAGC 3801 ACGTGCTACG AGATTTCGAT TCCACCGCCG CCTTCTATGA AAGGTTGGGC 3851 TTCGGAATCG TTTTCCGGGA CGCTGGCTGG ATGATCCTCC AGCGCGGGGA 3901 TCTCATGCTG GAGTTCTTCG CCCACCCCAA CTTGTTTATT GCAGCTTATA 3951 ATGGTTACAA ATAAAGCAAT AGCATCACAA ATTTCACAAA TAAAGCATTT 4001 TTTTCACTGC ATTCTAGTTG TGGTTTGTCC AAACTCATCA ATGTATCTTA 4051 TCATGTCTGT ATACCGTCGA CCTCTAGCTA GAGCTTGGCG TAATCATGGT 4101 CATAGCTGTT TCCTGTGTGA AATTGTTATC CGCTCACAAT TCCACACAAC 4151 ATACGAGCCG GAAGCATAAA GTGTAAAGCC TGGGGTGCCT AATGAGTGAG 4201 CTAACTCACA TTAATTGCGT TGCGCTCACT GCCCGCTTTC CAGTCGGGAA 4251 ACCTGTCGTG CCAGCTGCAT TAATGAATCG GCCAACGCGC GGGGAGAGGC 4301 GGTTTGCGTA TTGGGCGCTC TTCCGCTTCC TCGCTCACTG ACTCGCTGCG 4351 CTCGGTCGTT CGGCTGCGGC GAGCGGTATC AGCTCACTCA AAGGCGGTAA 4401 TACGGTTATC CACAGAATCA GGGGATAACG CAGGAAAGAA CATGTGAGCA 4451 AAAGGCCAGC AAAAGGCCAG GAACCGTAAA AAGGCCGCGT TGCTGGCGTT 4501 TTTCCATAGG CTCCGCCCCC CTGACGAGCA TCACAAAAAT CGACGCTCAA 4551 GTCAGAGGTG GCGAAACCCG ACAGGACTAT AAAGATACCA GGCGTTTCCC 4601 CCTGGAAGCT CCCTCGTGCG CTCTCCTGTT CCGACCCTGC CGCTTACCGG 4651 ATACCTGTCC GCCTTTCTCC CTTCGGGAAG CGTGGCGCTT TCTCATAGCT 4701 CACGCTGTAG GTATCTCAGT TCGGTGTAGG TCGTTCGCTC CAAGCTGGGC 4751 TGTGTGCACG AACCCCCCGT TCAGCCCGAC CGCTGCGCCT TATCCGGTAA 4801 CTATCGTCTT GAGTCCAACC CGGTAAGACA CGACTTATCG CCACTGGCAG 4851 CAGCCACTGG TAACAGGATT AGCAGAGCGA GGTATGTAGG CGGTGCTACA 4901 GAGTTCTTGA AGTGGTGGCC TAACTACGGC TACACTAGAA GAACAGTATT 4951 TGGTATCTGC GCTCTGCTGA AGCCAGTTAC CTTCGGAAAA AGAGTTGGTA 5001 GCTCTTGATC CGGCAAACAA ACCACCGCTG GTAGCGGTGG TTTTTTTGTT 5051 TGCAAGCAGC AGATTACGCG CAGAAAAAAA GGATCTCAAG AAGATCCTTT 5101 GATCTTTTCT ACGGGGTCTG AGCGCGGAAC CCCTATTTGT TTATTTTTCT 5151 AAATACATTC AAATATGTAT CCGCTCATGA ATTAATTCTT AGAAAAACTC 5201 ATCGAGCATC AAATGAAACT GCAATTTATT CATATCAGGA TTATCAATAC 5251 CATATTTTTG AAAAAGCCGT TTCTGTAATG AAGGAGAAAA CTCACCGAGG 5301 CAGTTCCATA GGATGGCAAG ATCCTGGTAT CGGTCTGCGA TTCCGACTCG 5351 TCCAACATCA ATACAACCTA TTAATTTCCC CTCGTCAAAA ATAAGGTTAT 5401 CAAGTGAGAA ATCACCATGA GTGACGACTG AATCCGGTGA GAATGGCAAA 5451 AGTTTATGCA TTTCTTTCCA GACTTGTTCA ACAGGCCAGC CATTACGCTC 5501 GTCATCAAAA TCACTCGCAT CAACCAAACC GTTATTCATT CGTGATTGCG 5551 CCTGAGCGAG ACGAAATACG CGATCGCTGT TAAAAGGACA ATTACAAACA 5601 GGAATCGAAT GCAACCGGCG CAGGAACACT GCCAGCGCAT CAACAATATT 5651 TTCACCTGAA TCAGGATATT CTTCTAATAC CTGGAATGCT GTTTTCCCAG 5701 GGATCGCAGT GGTGAGTAAC CATGCATCAT CAGGAGTACG GATAAAATGC 5751 TTGATGGTCG GAAGAGGCAT AAATTCCGTC AGCCAGTTTA GTCTGACCAT 5801 CTCATCTGTA ACATCATTGG CAACGCTACC TTTGCCATGT TTCAGAAACA 5851 ACTCTGGCGC ATCGGGCTTC CCATACAATC GATAGATTGT CGCACCTGAT 5901 TGCCCGACAT TATCGCGAGC CCATTTATAC CCATATAAAT CAGCATCCAT 5951 GTTGGAATTT AATCGCGGCC TAGAGCAAGA CGTTTCCCGT TGAATATGGC 6001 TCATAACACC CCTTGTATTA CTGTTTATGT AAGCAGACAG TTTTATTGTT 6051 CATGACCAAA ATCCCTTAAC GTGAGTTTTC GTTCCACTGA GCGTCAGACC 6101 CCGTAGAAAT CCGCGCACAT TTCCCCGAAA AGTGCCACCT GACGTC
Vector Tag
HA, N-terminus
Tag Information
Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA-tag is derived from the HA-molecule corresponding to amino acids 98-106 and has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA-tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins. The actual HA-tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3'. The amino acid sequence is: YPYDVPDYA.
Usage Summary
Most commercially available competent cells are appropriate for propagation of the plasmid, e.g. TOP10, DH5a, and TOP10F’.
About CTDNEP1 / DULLARD
O95476 NM_015343 NP_056158.2

Publications (0)

Customer Reviews (0)

Images

CTDNEP1 / DULLARD NucleicAcid

CTDNEP1 / DULLARD NucleicAcid

CTDNEP1 / DULLARD NucleicAcid

CTDNEP1 / DULLARD NucleicAcid

Requested From: United States
Date Requested: 8/13/2020