Products
Services
Research Areas
COVID-19
Resources
Contact Us
Distributors
Login
Quick Order
Cart
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Services
Immunohistochemistry Services

Work with LifeSpan to design a custom immunohistochemistry to address your specific biological question. Outsource the entire localization process without having to worry about finding and characterizing target specific antibodies, sourcing and validating difficult-to-find tissues, and having the ability to interpret the resulting immunostaining in relation to complex human pathologies.

TCR Screening Services

Test your therapeutic antibodies in immunohistochemistry against a broad panel of normal frozen human tissue types in order to determine potential unintended binding. Our non-GLP TCR services are designed on the FDA recommendation outlined in their "Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use".

Research Areas
Cell Cycle Pathways
Protein Family And Group
Infectious Disease
Contact Us
LSBio
2401 Fourth Avenue Suite 900
Seattle WA 98121
Phone:
866-819-4732 (Toll Free North America
206-374-1102 (International)
Fax:
866-206-6909 (Toll Free North America)
206-577-4565 (International)
How To Buy - Details about how to buy our products.
Orders@LSBio.com - To submit a new order.
Customer.Support@LSBio.com - To submit questions about existing orders, pricing, availability, bulk quotes, froforma invoice requests, or other billing issues.
Technical.Support@LSBio.com - To request technical information about an LSBio product or its applications
Sales@LSBio.com - To request information about fee-for-service contract IHC studies, IHC reports, distribution agreements, or general business development.
Worldwide Distributors List - To find your local distributor if you're not within the United States.
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Catalog Number Size Price
LS-N55588-1 1 Each $225 
RSRC1 NucleicAcid

Human RSRC1 Expression-Ready ORF Clone (pCMV3-N-OFP) LS-N55588

Human RSRC1 Expression-Ready ORF Clone (pCMV3-N-OFP) LS-N55588

Description:
Human RSRC1 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-N-OFP, with N-Terminal OFP tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-N-OFP
Other formats:
Price
Catalog Number
$225 
LS-N55588-1
1 Each

Estimated Shipping: 20 Business Days
Toll Free North America
866-819-4732
For Research Use Only

Overview

Description:
Human RSRC1 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-N-OFP, with N-Terminal OFP tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-N-OFP
Other formats:

Specifications

Type
Expression-Ready ORF Clone
Target
RSRC1
Synonyms
RSRC1 | SFRS21 | SRrp53 | BM-011
Species
Human
Insert Size
1005 bp
Cloning Enzymes Used
This construct is not yet assembled.
Presentation
Lyophilized
Reconstitution
  • Centrifuge at 5,000 x g for 5 minutes.
  • Carefully open the tube and add 100 µl of sterile water to dissolve the DNA.
  • Close the tube and incubate for 10 minutes at room temperature.
  • Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5,000 x g.
  • Store the plasmid at -20°C.
Storage
Store lyophilized at room temperature for up to three months.
Validation
The insert is confirmed by full-length sequencing with the sequencing primers listed.
Restrictions
For research use only. Intended for use by laboratory professionals.
Guarantee
This Expression-Ready ORF Clone carries the LSBio 100% Guarantee.
LSBio Guarantee
Vector
pCMV3-N-OFP
Vector Type
Expression Vector
Vector Information
All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
  • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
  • Hygromycin resistance gene for selection in mammalian cell lines.
  • A Kozak consensus sequence to enhance mammalian expression.
CMV promoter: bp 250-837
Enhancer: bp 838-1445
SV40 early promoter: bp 2987-3356
Hygromycin ORF: bp 3374-4399
pUC origin: bp 5042-5715
Kanamycin ORF: bp 5789-6604
Expression System
Mammalian
Expression Method
Constitutive, Stable/Transient
Promoter
CMV
Sequencing Primers
T7 - 5' TAATACGACTCACTATAGGG 3'
BGH - 5' TAGAAGGCACAGTCGAGG 3'
Vector Size
6746 bp
Vector Sequence
1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTGCACTCT CAGTACAATC 51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT 101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG 151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG 201 CTGCTTCGCG AGTACATTTA TATTGGCTCA TGTCCAATAT GACCGCCATG 251 TTGACATTGA TTATTGACTA GTTATTAATA GTAATCAATT ACGGGGTCAT 301 TAGTTCATAG CCCATATATG GAGTTCCGCG TTACATAACT TACGGTAAAT 351 GGCCCGCCTG GCTGACCGCC CAACGACCCC CGCCCATTGA CGTCAATAAT 401 GACGTATGTT CCCATAGTAA CGCCAATAGG GACTTTCCAT TGACGTCAAT 451 GGGTGGAGTA TTTACGGTAA ACTGCCCACT TGGCAGTACA TCAAGTGTAT 501 CATATGCCAA GTCCGCCCCC TATTGACGTC AATGACGGTA AATGGCCCGC 551 CTGGCATTAT GCCCAGTACA TGACCTTACG GGACTTTCCT ACTTGGCAGT 601 ACATCTACGT ATTAGTCATC GCTATTACCA TGGTGATGCG GTTTTGGCAG 651 TACACCAATG GGCGTGGATA GCGGTTTGAC TCACGGGGAT TTCCAAGTCT 701 CCACCCCATT GACGTCAATG GGAGTTTGTT TTGGCACCAA AATCAACGGG 751 ACTTTCCAAA ATGTCGTAAT AACCCCGCCC CGTTGACGCA AATGGGCGGT 801 AGGCGTGTAC GGTGGGAGGT CTATATAAGC AGAGCTCGTT TAGTGAACCG 851 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTTGG 901 GCTCGCGGTT GAGGACAAAC TCTTCGCGGT CTTTCCAGTA CTCTTGGATC 951 GGAAACCCGT CGGCCTCCGA ACGGTACTCC GCCACCGAGG GACCTGAGCG 1001 AGTCCGCATC GACCGGATCG GAAAACCTCT CGAGAAAGGC GTCTAACCAG 1051 TCACAGTCGC AAGGTAGGCT GAGCACCGTG GCGGGCGGCA GCGGGTGGCG 1101 GTCGGGGTTG TTTCTGGCGG AGGTGCTGCT GATGATGTAA TTAAAGTAGG 1151 CGGTCTTGAG ACGGCGGATG GTCGAGGTGA GGTGTGGGTT TAGTGAACCG 1201 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTCAG 1251 GCTTGAGATC CAGCTGTTGG GGTGAGTACT CCCTCTCAAA AGCGGGCATT 1301 ACTTCTGCGC TAAGATTGTC AGTTTCCAAA AACGAGGAGG ATTTGATATT 1351 CACCTGGCCC GATCTGGCCA TACACTTGAG TGACAATGAC ATCCACTTTG 1401 CCTTTCTCTC CACAGGTGTC CACTCCCAGG TCCAAGTTTA AACTTTAATA 1451 CGACTCACTA TAGGGGCCGC CACCAAGCTT GGTACCATGG ATAGCACTGA 1501 GAACGTCATC AAGCCCTTCA TGCGCTTCAA GGTGCACATG GAGGGCTCCG 1551 TGAACGGCCA CGAGTTCGAG ATCGAGGGCG TGGGCGAGGG CCGCCCCTAC 1601 GAGGGCTTTC AGACCGCTAA GCTGAAGGTG ACCAAGGGTG GCCCCCTGCC 1651 CTTCGCCTGG GACATCCTGT CCCCTCATTT CACCTACGGC TCCAAGGCCT 1701 ACGTGAAGCA CCCCGCCGAC ATCCCCGACT ACTTGAAGCT GTCCTTCCCC 1751 GAGGGCTTCA AGTGGGAGCG CGTGATGAAC TACGAGGACG GCGGCGTGGT 1801 GACCGTGACC CAGGACTCCT CCCTACAGGA CGGCGAGTTC ATCTACAAGG 1851 TGAAGCTGCG CGGCACCAAC TTCCCCTCCG ACGGCCCCGT GATGCAGAAG 1901 AAGACCATGG GCTGGGAGGC CTCCTCCGAG CGGATGTACC CCGAGGACGG 1951 TGCCCTGAAG GGCAAGATCA AGATGAGGCT GAAGCTGAAG GACGGCGGCC 2001 ACTACACCTC CGAGGTCAAG ACCACCTACA AGGCCAAGAA GCCCGTGCAG 2051 CTGCCCGGCG CCTACATCGT CGACATCAAG TTGGACATCA CCTCCCACAA 2101 CGAGGACTAC ACCATCGTGG AACAGTACGA ACGCGCCGAG GGCCGCCACC 2151 ACCTGTTCCA GGGTGGAGGC GGTAGCGCTG CTAGCGGATC CGTTAACCTT 2201 AAGACCGGTG ATATCATCGA TTAAACTCGA GTCTAGAGCG GCCGCCGAAT 2251 TCGGGCCCGT TTAAACCCGC TGATCAGCCT CGACTGTGCC TTCTAGTTGC 2301 CAGCCATCTG TTGTTTGCCC CTCCCCCGTG CCTTCCTTGA CCCTGGAAGG 2351 TGCCACTCCC ACTGTCCTTT CCTAATAAAA TGAGGAAATT GCATCGCATT 2401 GTCTGAGTAG GTGTCATTCT ATTCTGGGGG GTGGGGTGGG GCAGGACAGC 2451 AAGGGGGAGG ATTGGGAAGA CAATAGCAGG CATGCTGGGG ATGCGGTGGG 2501 CTCTATGGCT TCTGAGGCGG AAAGAACCAG CTGGGGCTCT AGGGGGTATC 2551 CCCACGCGCC CTGTAGCGGC GCATTAAGCG CGGCGGGTGT GGTGGTTACG 2601 CGCAGCGTGA CCGCTACACT TGCCAGCGCC CTAGCGCCCG CTCCTTTCGC 2651 TTTCTTCCCT TCCTTTCTCG CCACGTTCGC AGGCTTTCCC CGTCAAGCTC 2701 TAAATCGGGG GCTCCCTTTA GGGTTCCGAT TTAGTGCTTT ACGGCACCTC 2751 GACCCCAAAA AACTTGATTA GGGTGATGGT TCACGTAGTG GGCCATCGCC 2801 CTGATAGACG GTTTTTCGCC CTTTGACGTT GGAGTCCACG TTCTTTAATA 2851 GTGGACTCTT GTTCCAAACT GGAACAACAC TCAACCCTAT CTCGGTCTAT 2901 TCTTTTGATT TATAAGGGAT TTTGCCGATT TCGGCCTATT GGTTAAAAAA 2951 TGAGCTGATT TAACAAAAAT TTAACGCGAA TTAATTCTGT GGAATGTGTG 3001 TCAGTTAGGG TGTGGAAAGT CCCCAGGCTC CCCAGCAGGC AGAAGTATGC 3051 AAAGCATGCA TCTCAATTAG TCAGCAACCA GGTGTGGAAA GTCCCCAGGC 3101 TCCCCAGCAG GCAGAAGTAT GCAAAGCATG CATCTCAATT AGTCAGCAAC 3151 CATAGTCCCG CCCCTAACTC CGCCCATCCC GCCCCTAACT CCGCCCAGTT 3201 CCGCCCATTC TCCGCCCCAT GGCTGACTAA TTTTTTTTAT TTATGCAGAG 3251 GCCGAGGCCG CCTCTGCCTC TGAGCTATTC CAGAAGTAGT GAGGAGGCTT 3301 TTTTGGAGGC CTAGGCTTTT GCAAAAAGCT CTCGGGAGCT TGTATATCCA 3351 TTTTCGGATC TGATCAGCAC GTGATGAAAA AGCCTGAACT CACCGCGACG 3401 TCTGTCGAGA AGTTTCTGAT CGAAAAGTTC GACAGCGTCT CCGACCTGAT 3451 GCAGCTCTCG GAGGGCGAAG AATCTCGTGC TTTCAGCTTC GATGTAGGAG 3501 GGCGTGGATA TGTCCTGCGG GTAAATAGCT GCGCCGATGG TTTCTACAAA 3551 GATCGTTATG TTTATCGGCA CTTTGCATCG GCCGCGCTCC CGATTCCGGA 3601 AGTGCTTGAC ATTGGGGAAT TCAGCGAGAG CCTGACCTAT TGCATCTCCC 3651 GCCGTGCACA GGGTGTCACG TTGCAAGACC TGCCTGAAAC CGAACTGCCC 3701 GCTGTTCTGC AGCCGGTCGC GGAGGCCATG GATGCGATCG CTGCGGCCGA 3751 TCTTAGCCAG ACGAGCGGGT TCGGCCCATT CGGACCGCAA GGAATCGGTC 3801 AATACACTAC ATGGCGTGAT TTCATATGCG CGATTGCTGA TCCCCATGTG 3851 TATCACTGGC AAACTGTGAT GGACGACACC GTCAGTGCGT CCGTCGCGCA 3901 GGCTCTCGAT GAGCTGATGC TTTGGGCCGA GGACTGCCCC GAAGTCCGGC 3951 ACCTCGTGCA CGCGGATTTC GGCTCCAACA ATGTCCTGAC GGACAATGGC 4001 CGCATAACAG CGGTCATTGA CTGGAGCGAG GCGATGTTCG GGGATTCCCA 4051 ATACGAGGTC GCCAACATCT TCTTCTGGAG GCCGTGGTTG GCTTGTATGG 4101 AGCAGCAGAC GCGCTACTTC GAGCGGAGGC ATCCGGAGCT TGCAGGATCG 4151 CCGCGGCTCC GGGCGTATAT GCTCCGCATT GGTCTTGACC AACTCTATCA 4201 GAGCTTGGTT GACGGCAATT TCGATGATGC AGCTTGGGCG CAGGGTCGAT 4251 GCGACGCAAT CGTCCGATCC GGAGCCGGGA CTGTCGGGCG TACACAAATC 4301 GCCCGCAGAA GCGCGGCCGT CTGGACCGAT GGCTGTGTAG AAGTACTCGC 4351 CGATAGTGGA AACCGACGCC CCAGCACTCG TCCGAGGGCA AAGGAATAGC 4401 ACGTGCTACG AGATTTCGAT TCCACCGCCG CCTTCTATGA AAGGTTGGGC 4451 TTCGGAATCG TTTTCCGGGA CGCTGGCTGG ATGATCCTCC AGCGCGGGGA 4501 TCTCATGCTG GAGTTCTTCG CCCACCCCAA CTTGTTTATT GCAGCTTATA 4551 ATGGTTACAA ATAAAGCAAT AGCATCACAA ATTTCACAAA TAAAGCATTT 4601 TTTTCACTGC ATTCTAGTTG TGGTTTGTCC AAACTCATCA ATGTATCTTA 4651 TCATGTCTGT ATACCGTCGA CCTCTAGCTA GAGCTTGGCG TAATCATGGT 4701 CATAGCTGTT TCCTGTGTGA AATTGTTATC CGCTCACAAT TCCACACAAC 4751 ATACGAGCCG GAAGCATAAA GTGTAAAGCC TGGGGTGCCT AATGAGTGAG 4801 CTAACTCACA TTAATTGCGT TGCGCTCACT GCCCGCTTTC CAGTCGGGAA 4851 ACCTGTCGTG CCAGCTGCAT TAATGAATCG GCCAACGCGC GGGGAGAGGC 4901 GGTTTGCGTA TTGGGCGCTC TTCCGCTTCC TCGCTCACTG ACTCGCTGCG 4951 CTCGGTCGTT CGGCTGCGGC GAGCGGTATC AGCTCACTCA AAGGCGGTAA 5001 TACGGTTATC CACAGAATCA GGGGATAACG CAGGAAAGAA CATGTGAGCA 5051 AAAGGCCAGC AAAAGGCCAG GAACCGTAAA AAGGCCGCGT TGCTGGCGTT 5101 TTTCCATAGG CTCCGCCCCC CTGACGAGCA TCACAAAAAT CGACGCTCAA 5151 GTCAGAGGTG GCGAAACCCG ACAGGACTAT AAAGATACCA GGCGTTTCCC 5201 CCTGGAAGCT CCCTCGTGCG CTCTCCTGTT CCGACCCTGC CGCTTACCGG 5251 ATACCTGTCC GCCTTTCTCC CTTCGGGAAG CGTGGCGCTT TCTCATAGCT 5301 CACGCTGTAG GTATCTCAGT TCGGTGTAGG TCGTTCGCTC CAAGCTGGGC 5351 TGTGTGCACG AACCCCCCGT TCAGCCCGAC CGCTGCGCCT TATCCGGTAA 5401 CTATCGTCTT GAGTCCAACC CGGTAAGACA CGACTTATCG CCACTGGCAG 5451 CAGCCACTGG TAACAGGATT AGCAGAGCGA GGTATGTAGG CGGTGCTACA 5501 GAGTTCTTGA AGTGGTGGCC TAACTACGGC TACACTAGAA GAACAGTATT 5551 TGGTATCTGC GCTCTGCTGA AGCCAGTTAC CTTCGGAAAA AGAGTTGGTA 5601 GCTCTTGATC CGGCAAACAA ACCACCGCTG GTAGCGGTGG TTTTTTTGTT 5651 TGCAAGCAGC AGATTACGCG CAGAAAAAAA GGATCTCAAG AAGATCCTTT 5701 GATCTTTTCT ACGGGGTCTG AGCGCGGAAC CCCTATTTGT TTATTTTTCT 5751 AAATACATTC AAATATGTAT CCGCTCATGA ATTAATTCTT AGAAAAACTC 5801 ATCGAGCATC AAATGAAACT GCAATTTATT CATATCAGGA TTATCAATAC 5851 CATATTTTTG AAAAAGCCGT TTCTGTAATG AAGGAGAAAA CTCACCGAGG 5901 CAGTTCCATA GGATGGCAAG ATCCTGGTAT CGGTCTGCGA TTCCGACTCG 5951 TCCAACATCA ATACAACCTA TTAATTTCCC CTCGTCAAAA ATAAGGTTAT 6001 CAAGTGAGAA ATCACCATGA GTGACGACTG AATCCGGTGA GAATGGCAAA 6051 AGTTTATGCA TTTCTTTCCA GACTTGTTCA ACAGGCCAGC CATTACGCTC 6101 GTCATCAAAA TCACTCGCAT CAACCAAACC GTTATTCATT CGTGATTGCG 6151 CCTGAGCGAG ACGAAATACG CGATCGCTGT TAAAAGGACA ATTACAAACA 6201 GGAATCGAAT GCAACCGGCG CAGGAACACT GCCAGCGCAT CAACAATATT 6251 TTCACCTGAA TCAGGATATT CTTCTAATAC CTGGAATGCT GTTTTCCCAG 6301 GGATCGCAGT GGTGAGTAAC CATGCATCAT CAGGAGTACG GATAAAATGC 6351 TTGATGGTCG GAAGAGGCAT AAATTCCGTC AGCCAGTTTA GTCTGACCAT 6401 CTCATCTGTA ACATCATTGG CAACGCTACC TTTGCCATGT TTCAGAAACA 6451 ACTCTGGCGC ATCGGGCTTC CCATACAATC GATAGATTGT CGCACCTGAT 6501 TGCCCGACAT TATCGCGAGC CCATTTATAC CCATATAAAT CAGCATCCAT 6551 GTTGGAATTT AATCGCGGCC TAGAGCAAGA CGTTTCCCGT TGAATATGGC 6601 TCATAACACC CCTTGTATTA CTGTTTATGT AAGCAGACAG TTTTATTGTT 6651 CATGACCAAA ATCCCTTAAC GTGAGTTTTC GTTCCACTGA GCGTCAGACC 6701 CCGTAGAAAT CCGCGCACAT TTCCCCGAAA AGTGCCACCT GACGTC
Vector Tag
OFP, N-terminus
Tag Information
An OFP-tag is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, the OFP-tag is more than twice brighter than mOrange2. The OFP-tag's fast maturation makes it clearly detectable in mammalian cells as early as 8 hours after transfection. The OFP-tag can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFP-tagged expression vectors produce bright fluorescence within 8 hours after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, the OFP-tag performs well in some fusion and protein labeling applications.
Usage Summary
Most commercially available competent cells are appropriate for propagation of the plasmid, e.g. TOP10, DH5a, and TOP10F’.
About RSRC1
Q96IZ7 NM_016625 NP_057709.2

Publications (0)

Customer Reviews (0)

Images

RSRC1 NucleicAcid

RSRC1 NucleicAcid

RSRC1 NucleicAcid

RSRC1 NucleicAcid

Requested From: United States
Date Requested: 8/9/2020