Products
Services
Research Areas
COVID-19
Resources
Contact Us
Distributors
Login
Quick Order
Cart
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Services
Immunohistochemistry Services

Work with LifeSpan to design a custom immunohistochemistry to address your specific biological question. Outsource the entire localization process without having to worry about finding and characterizing target specific antibodies, sourcing and validating difficult-to-find tissues, and having the ability to interpret the resulting immunostaining in relation to complex human pathologies.

TCR Screening Services

Test your therapeutic antibodies in immunohistochemistry against a broad panel of normal frozen human tissue types in order to determine potential unintended binding. Our non-GLP TCR services are designed on the FDA recommendation outlined in their "Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use".

Research Areas
Cell Cycle Pathways
Protein Family And Group
Infectious Disease
Contact Us
LSBio
2401 Fourth Avenue Suite 900
Seattle WA 98121
Phone:
866-819-4732 (Toll Free North America
206-374-1102 (International)
Fax:
866-206-6909 (Toll Free North America)
206-577-4565 (International)
How To Buy - Details about how to buy our products.
Orders@LSBio.com - To submit a new order.
Customer.Support@LSBio.com - To submit questions about existing orders, pricing, availability, bulk quotes, froforma invoice requests, or other billing issues.
Technical.Support@LSBio.com - To request technical information about an LSBio product or its applications
Sales@LSBio.com - To request information about fee-for-service contract IHC studies, IHC reports, distribution agreements, or general business development.
Worldwide Distributors List - To find your local distributor if you're not within the United States.
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Catalog Number Size Price
LS-N56473-1 1 Each $196 
PEX7 NucleicAcid

Human PEX7 Expression-Ready ORF Clone (pCMV3-N-HA) LS-N56473

Human PEX7 Expression-Ready ORF Clone (pCMV3-N-HA) LS-N56473

Description:
Human PEX7 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-N-HA, with N-Terminal HA tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-N-HA
Other formats:
Price
Catalog Number
$196 
LS-N56473-1
1 Each

Estimated Shipping: 20 Business Days
Toll Free North America
866-819-4732
For Research Use Only

Overview

Description:
Human PEX7 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-N-HA, with N-Terminal HA tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-N-HA
Other formats:

Specifications

Type
Expression-Ready ORF Clone
Target
PEX7
Synonyms
PEX7 | Hspex7p | PBD9B | Peroxin-7 | Peroxisomal PTS2 receptor | RD | PTS2R | RCDP1 | PTS2 receptor
Species
Human
Insert Size
972 bp
Cloning Enzymes Used
This construct is not yet assembled.
Presentation
Lyophilized
Reconstitution
  • Centrifuge at 5,000 x g for 5 minutes.
  • Carefully open the tube and add 100 µl of sterile water to dissolve the DNA.
  • Close the tube and incubate for 10 minutes at room temperature.
  • Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5,000 x g.
  • Store the plasmid at -20°C.
Storage
Store lyophilized at room temperature for up to three months.
Validation
The insert is confirmed by full-length sequencing with the sequencing primers listed.
Restrictions
For research use only. Intended for use by laboratory professionals.
Guarantee
This Expression-Ready ORF Clone carries the LSBio 100% Guarantee.
LSBio Guarantee
Vector
pCMV3-N-HA
Vector Type
Expression Vector
Vector Information
All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
  • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
  • Hygromycin resistance gene for selection in mammalian cell lines.
  • A Kozak consensus sequence to enhance mammalian expression.
This vector is suitable for intracellular protein expression.
CMV promoter: bp 250-837
Enhancer: bp 838-1445
SV40 early promoter: bp 2342-2711
Hygromycin ORF: bp 2729-3754
pUC origin: bp 4397-5070
Kanamycin ORF: bp 5144-5959
Expression System
Mammalian
Expression Method
Constitutive, Stable/Transient
Promoter
CMV
Sequencing Primers
T7 - 5' TAATACGACTCACTATAGGG 3'
BGH - 5' TAGAAGGCACAGTCGAGG 3'
Vector Size
6101 bp
Vector Sequence
1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTGCACTCT CAGTACAATC 51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT 101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG 151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG 201 CTGCTTCGCG AGTACATTTA TATTGGCTCA TGTCCAATAT GACCGCCATG 251 TTGACATTGA TTATTGACTA GTTATTAATA GTAATCAATT ACGGGGTCAT 301 TAGTTCATAG CCCATATATG GAGTTCCGCG TTACATAACT TACGGTAAAT 351 GGCCCGCCTG GCTGACCGCC CAACGACCCC CGCCCATTGA CGTCAATAAT 401 GACGTATGTT CCCATAGTAA CGCCAATAGG GACTTTCCAT TGACGTCAAT 451 GGGTGGAGTA TTTACGGTAA ACTGCCCACT TGGCAGTACA TCAAGTGTAT 501 CATATGCCAA GTCCGCCCCC TATTGACGTC AATGACGGTA AATGGCCCGC 551 CTGGCATTAT GCCCAGTACA TGACCTTACG GGACTTTCCT ACTTGGCAGT 601 ACATCTACGT ATTAGTCATC GCTATTACCA TGGTGATGCG GTTTTGGCAG 651 TACACCAATG GGCGTGGATA GCGGTTTGAC TCACGGGGAT TTCCAAGTCT 701 CCACCCCATT GACGTCAATG GGAGTTTGTT TTGGCACCAA AATCAACGGG 751 ACTTTCCAAA ATGTCGTAAT AACCCCGCCC CGTTGACGCA AATGGGCGGT 801 AGGCGTGTAC GGTGGGAGGT CTATATAAGC AGAGCTCGTT TAGTGAACCG 851 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTTGG 901 GCTCGCGGTT GAGGACAAAC TCTTCGCGGT CTTTCCAGTA CTCTTGGATC 951 GGAAACCCGT CGGCCTCCGA ACGGTACTCC GCCACCGAGG GACCTGAGCG 1001 AGTCCGCATC GACCGGATCG GAAAACCTCT CGAGAAAGGC GTCTAACCAG 1051 TCACAGTCGC AAGGTAGGCT GAGCACCGTG GCGGGCGGCA GCGGGTGGCG 1101 GTCGGGGTTG TTTCTGGCGG AGGTGCTGCT GATGATGTAA TTAAAGTAGG 1151 CGGTCTTGAG ACGGCGGATG GTCGAGGTGA GGTGTGGGTT TAGTGAACCG 1201 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTCAG 1251 GCTTGAGATC CAGCTGTTGG GGTGAGTACT CCCTCTCAAA AGCGGGCATT 1301 ACTTCTGCGC TAAGATTGTC AGTTTCCAAA AACGAGGAGG ATTTGATATT 1351 CACCTGGCCC GATCTGGCCA TACACTTGAG TGACAATGAC ATCCACTTTG 1401 CCTTTCTCTC CACAGGTGTC CACTCCCAGG TCCAAGTTTA AACTTTAATA 1451 CGACTCACTA TAGGGGCCGC CACCAAGCTT GGTACCATGT ATCCTTACGA 1501 CGTGCCTGAC TACGCCGGTG GAGGCGGTAG CGCTGCTAGC GGATCCGTTA 1551 ACCTTAAGAC CGGTGATATC ATCGATTAAA CTCGAGTCTA GAGCGGCCGC 1601 CGAATTCGGG CCCGTTTAAA CCCGCTGATC AGCCTCGACT GTGCCTTCTA 1651 GTTGCCAGCC ATCTGTTGTT TGCCCCTCCC CCGTGCCTTC CTTGACCCTG 1701 GAAGGTGCCA CTCCCACTGT CCTTTCCTAA TAAAATGAGG AAATTGCATC 1751 GCATTGTCTG AGTAGGTGTC ATTCTATTCT GGGGGGTGGG GTGGGGCAGG 1801 ACAGCAAGGG GGAGGATTGG GAAGACAATA GCAGGCATGC TGGGGATGCG 1851 GTGGGCTCTA TGGCTTCTGA GGCGGAAAGA ACCAGCTGGG GCTCTAGGGG 1901 GTATCCCCAC GCGCCCTGTA GCGGCGCATT AAGCGCGGCG GGTGTGGTGG 1951 TTACGCGCAG CGTGACCGCT ACACTTGCCA GCGCCCTAGC GCCCGCTCCT 2001 TTCGCTTTCT TCCCTTCCTT TCTCGCCACG TTCGCAGGCT TTCCCCGTCA 2051 AGCTCTAAAT CGGGGGCTCC CTTTAGGGTT CCGATTTAGT GCTTTACGGC 2101 ACCTCGACCC CAAAAAACTT GATTAGGGTG ATGGTTCACG TAGTGGGCCA 2151 TCGCCCTGAT AGACGGTTTT TCGCCCTTTG ACGTTGGAGT CCACGTTCTT 2201 TAATAGTGGA CTCTTGTTCC AAACTGGAAC AACACTCAAC CCTATCTCGG 2251 TCTATTCTTT TGATTTATAA GGGATTTTGC CGATTTCGGC CTATTGGTTA 2301 AAAAATGAGC TGATTTAACA AAAATTTAAC GCGAATTAAT TCTGTGGAAT 2351 GTGTGTCAGT TAGGGTGTGG AAAGTCCCCA GGCTCCCCAG CAGGCAGAAG 2401 TATGCAAAGC ATGCATCTCA ATTAGTCAGC AACCAGGTGT GGAAAGTCCC 2451 CAGGCTCCCC AGCAGGCAGA AGTATGCAAA GCATGCATCT CAATTAGTCA 2501 GCAACCATAG TCCCGCCCCT AACTCCGCCC ATCCCGCCCC TAACTCCGCC 2551 CAGTTCCGCC CATTCTCCGC CCCATGGCTG ACTAATTTTT TTTATTTATG 2601 CAGAGGCCGA GGCCGCCTCT GCCTCTGAGC TATTCCAGAA GTAGTGAGGA 2651 GGCTTTTTTG GAGGCCTAGG CTTTTGCAAA AAGCTCTCGG GAGCTTGTAT 2701 ATCCATTTTC GGATCTGATC AGCACGTGAT GAAAAAGCCT GAACTCACCG 2751 CGACGTCTGT CGAGAAGTTT CTGATCGAAA AGTTCGACAG CGTCTCCGAC 2801 CTGATGCAGC TCTCGGAGGG CGAAGAATCT CGTGCTTTCA GCTTCGATGT 2851 AGGAGGGCGT GGATATGTCC TGCGGGTAAA TAGCTGCGCC GATGGTTTCT 2901 ACAAAGATCG TTATGTTTAT CGGCACTTTG CATCGGCCGC GCTCCCGATT 2951 CCGGAAGTGC TTGACATTGG GGAATTCAGC GAGAGCCTGA CCTATTGCAT 3001 CTCCCGCCGT GCACAGGGTG TCACGTTGCA AGACCTGCCT GAAACCGAAC 3051 TGCCCGCTGT TCTGCAGCCG GTCGCGGAGG CCATGGATGC GATCGCTGCG 3101 GCCGATCTTA GCCAGACGAG CGGGTTCGGC CCATTCGGAC CGCAAGGAAT 3151 CGGTCAATAC ACTACATGGC GTGATTTCAT ATGCGCGATT GCTGATCCCC 3201 ATGTGTATCA CTGGCAAACT GTGATGGACG ACACCGTCAG TGCGTCCGTC 3251 GCGCAGGCTC TCGATGAGCT GATGCTTTGG GCCGAGGACT GCCCCGAAGT 3301 CCGGCACCTC GTGCACGCGG ATTTCGGCTC CAACAATGTC CTGACGGACA 3351 ATGGCCGCAT AACAGCGGTC ATTGACTGGA GCGAGGCGAT GTTCGGGGAT 3401 TCCCAATACG AGGTCGCCAA CATCTTCTTC TGGAGGCCGT GGTTGGCTTG 3451 TATGGAGCAG CAGACGCGCT ACTTCGAGCG GAGGCATCCG GAGCTTGCAG 3501 GATCGCCGCG GCTCCGGGCG TATATGCTCC GCATTGGTCT TGACCAACTC 3551 TATCAGAGCT TGGTTGACGG CAATTTCGAT GATGCAGCTT GGGCGCAGGG 3601 TCGATGCGAC GCAATCGTCC GATCCGGAGC CGGGACTGTC GGGCGTACAC 3651 AAATCGCCCG CAGAAGCGCG GCCGTCTGGA CCGATGGCTG TGTAGAAGTA 3701 CTCGCCGATA GTGGAAACCG ACGCCCCAGC ACTCGTCCGA GGGCAAAGGA 3751 ATAGCACGTG CTACGAGATT TCGATTCCAC CGCCGCCTTC TATGAAAGGT 3801 TGGGCTTCGG AATCGTTTTC CGGGACGCTG GCTGGATGAT CCTCCAGCGC 3851 GGGGATCTCA TGCTGGAGTT CTTCGCCCAC CCCAACTTGT TTATTGCAGC 3901 TTATAATGGT TACAAATAAA GCAATAGCAT CACAAATTTC ACAAATAAAG 3951 CATTTTTTTC ACTGCATTCT AGTTGTGGTT TGTCCAAACT CATCAATGTA 4001 TCTTATCATG TCTGTATACC GTCGACCTCT AGCTAGAGCT TGGCGTAATC 4051 ATGGTCATAG CTGTTTCCTG TGTGAAATTG TTATCCGCTC ACAATTCCAC 4101 ACAACATACG AGCCGGAAGC ATAAAGTGTA AAGCCTGGGG TGCCTAATGA 4151 GTGAGCTAAC TCACATTAAT TGCGTTGCGC TCACTGCCCG CTTTCCAGTC 4201 GGGAAACCTG TCGTGCCAGC TGCATTAATG AATCGGCCAA CGCGCGGGGA 4251 GAGGCGGTTT GCGTATTGGG CGCTCTTCCG CTTCCTCGCT CACTGACTCG 4301 CTGCGCTCGG TCGTTCGGCT GCGGCGAGCG GTATCAGCTC ACTCAAAGGC 4351 GGTAATACGG TTATCCACAG AATCAGGGGA TAACGCAGGA AAGAACATGT 4401 GAGCAAAAGG CCAGCAAAAG GCCAGGAACC GTAAAAAGGC CGCGTTGCTG 4451 GCGTTTTTCC ATAGGCTCCG CCCCCCTGAC GAGCATCACA AAAATCGACG 4501 CTCAAGTCAG AGGTGGCGAA ACCCGACAGG ACTATAAAGA TACCAGGCGT 4551 TTCCCCCTGG AAGCTCCCTC GTGCGCTCTC CTGTTCCGAC CCTGCCGCTT 4601 ACCGGATACC TGTCCGCCTT TCTCCCTTCG GGAAGCGTGG CGCTTTCTCA 4651 TAGCTCACGC TGTAGGTATC TCAGTTCGGT GTAGGTCGTT CGCTCCAAGC 4701 TGGGCTGTGT GCACGAACCC CCCGTTCAGC CCGACCGCTG CGCCTTATCC 4751 GGTAACTATC GTCTTGAGTC CAACCCGGTA AGACACGACT TATCGCCACT 4801 GGCAGCAGCC ACTGGTAACA GGATTAGCAG AGCGAGGTAT GTAGGCGGTG 4851 CTACAGAGTT CTTGAAGTGG TGGCCTAACT ACGGCTACAC TAGAAGAACA 4901 GTATTTGGTA TCTGCGCTCT GCTGAAGCCA GTTACCTTCG GAAAAAGAGT 4951 TGGTAGCTCT TGATCCGGCA AACAAACCAC CGCTGGTAGC GGTGGTTTTT 5001 TTGTTTGCAA GCAGCAGATT ACGCGCAGAA AAAAAGGATC TCAAGAAGAT 5051 CCTTTGATCT TTTCTACGGG GTCTGAGCGC GGAACCCCTA TTTGTTTATT 5101 TTTCTAAATA CATTCAAATA TGTATCCGCT CATGAATTAA TTCTTAGAAA 5151 AACTCATCGA GCATCAAATG AAACTGCAAT TTATTCATAT CAGGATTATC 5201 AATACCATAT TTTTGAAAAA GCCGTTTCTG TAATGAAGGA GAAAACTCAC 5251 CGAGGCAGTT CCATAGGATG GCAAGATCCT GGTATCGGTC TGCGATTCCG 5301 ACTCGTCCAA CATCAATACA ACCTATTAAT TTCCCCTCGT CAAAAATAAG 5351 GTTATCAAGT GAGAAATCAC CATGAGTGAC GACTGAATCC GGTGAGAATG 5401 GCAAAAGTTT ATGCATTTCT TTCCAGACTT GTTCAACAGG CCAGCCATTA 5451 CGCTCGTCAT CAAAATCACT CGCATCAACC AAACCGTTAT TCATTCGTGA 5501 TTGCGCCTGA GCGAGACGAA ATACGCGATC GCTGTTAAAA GGACAATTAC 5551 AAACAGGAAT CGAATGCAAC CGGCGCAGGA ACACTGCCAG CGCATCAACA 5601 ATATTTTCAC CTGAATCAGG ATATTCTTCT AATACCTGGA ATGCTGTTTT 5651 CCCAGGGATC GCAGTGGTGA GTAACCATGC ATCATCAGGA GTACGGATAA 5701 AATGCTTGAT GGTCGGAAGA GGCATAAATT CCGTCAGCCA GTTTAGTCTG 5751 ACCATCTCAT CTGTAACATC ATTGGCAACG CTACCTTTGC CATGTTTCAG 5801 AAACAACTCT GGCGCATCGG GCTTCCCATA CAATCGATAG ATTGTCGCAC 5851 CTGATTGCCC GACATTATCG CGAGCCCATT TATACCCATA TAAATCAGCA 5901 TCCATGTTGG AATTTAATCG CGGCCTAGAG CAAGACGTTT CCCGTTGAAT 5951 ATGGCTCATA ACACCCCTTG TATTACTGTT TATGTAAGCA GACAGTTTTA 6001 TTGTTCATGA CCAAAATCCC TTAACGTGAG TTTTCGTTCC ACTGAGCGTC 6051 AGACCCCGTA GAAATCCGCG CACATTTCCC CGAAAAGTGC CACCTGACGT 6101 C
Vector Tag
HA, N-terminus
Tag Information
Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA-tag is derived from the HA-molecule corresponding to amino acids 98-106 and has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA-tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins. The actual HA-tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3'. The amino acid sequence is: YPYDVPDYA.
Usage Summary
Most commercially available competent cells are appropriate for propagation of the plasmid, e.g. TOP10, DH5a, and TOP10F’.
About PEX7
O00628 NM_000288 NP_000279.1

Publications (0)

Customer Reviews (0)

Images

PEX7 NucleicAcid

PEX7 NucleicAcid

PEX7 NucleicAcid

PEX7 NucleicAcid

Requested From: United States
Date Requested: 8/9/2020