Products
Services
Research Areas
COVID-19
Resources
Contact Us
Distributors
Login
Quick Order
Cart
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Services
Immunohistochemistry Services

Work with LifeSpan to design a custom immunohistochemistry to address your specific biological question. Outsource the entire localization process without having to worry about finding and characterizing target specific antibodies, sourcing and validating difficult-to-find tissues, and having the ability to interpret the resulting immunostaining in relation to complex human pathologies.

TCR Screening Services

Test your therapeutic antibodies in immunohistochemistry against a broad panel of normal frozen human tissue types in order to determine potential unintended binding. Our non-GLP TCR services are designed on the FDA recommendation outlined in their "Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use".

Research Areas
Cell Cycle Pathways
Protein Family And Group
Infectious Disease
Contact Us
LSBio
2401 Fourth Avenue Suite 900
Seattle WA 98121
Phone:
866-819-4732 (Toll Free North America
206-374-1102 (International)
Fax:
866-206-6909 (Toll Free North America)
206-577-4565 (International)
How To Buy - Details about how to buy our products.
Orders@LSBio.com - To submit a new order.
Customer.Support@LSBio.com - To submit questions about existing orders, pricing, availability, bulk quotes, froforma invoice requests, or other billing issues.
Technical.Support@LSBio.com - To request technical information about an LSBio product or its applications
Sales@LSBio.com - To request information about fee-for-service contract IHC studies, IHC reports, distribution agreements, or general business development.
Worldwide Distributors List - To find your local distributor if you're not within the United States.
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Catalog Number Size Price
LS-N53198-1 1 Each $216 
MTMR12 NucleicAcid

Human MTMR12 Expression-Ready ORF Clone (pCMV3-N-Myc) LS-N53198

Human MTMR12 Expression-Ready ORF Clone (pCMV3-N-Myc) LS-N53198

Description:
Human MTMR12 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-N-Myc, with N-Terminal Myc tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-N-Myc
Other formats:
Price
Catalog Number
$216 
LS-N53198-1
1 Each

Estimated Shipping: 20 Business Days
Toll Free North America
866-819-4732
For Research Use Only

Overview

Description:
Human MTMR12 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-N-Myc, with N-Terminal Myc tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-N-Myc
Other formats:

Specifications

Type
Expression-Ready ORF Clone
Target
MTMR12
Synonyms
MTMR12 | 3PAP | 3-PAP | 3-phosphatase adapter protein | 3-phosphatase adapter subunit | PIP3AP | KIAA1682
Species
Human
Insert Size
2082 bp
Cloning Enzymes Used
This construct is not yet assembled.
Presentation
Lyophilized
Reconstitution
  • Centrifuge at 5,000 x g for 5 minutes.
  • Carefully open the tube and add 100 µl of sterile water to dissolve the DNA.
  • Close the tube and incubate for 10 minutes at room temperature.
  • Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5,000 x g.
  • Store the plasmid at -20°C.
Storage
Store lyophilized at room temperature for up to three months.
Validation
The insert is confirmed by full-length sequencing with the sequencing primers listed.
Restrictions
For research use only. Intended for use by laboratory professionals.
Guarantee
This Expression-Ready ORF Clone carries the LSBio 100% Guarantee.
LSBio Guarantee
Vector
pCMV3-N-Myc
Vector Type
Expression Vector
Vector Information
All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
  • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
  • Hygromycin resistance gene for selection in mammalian cell lines.
  • A Kozak consensus sequence to enhance mammalian expression.
This vector is suitable for intracellular protein expression.
CMV promoter: bp 250-837
Enhancer: bp 838-1445
SV40 early promoter: bp 2345-2714
Hygromycin ORF: bp 2732-3757
pUC origin: bp 4400-5073
Kanamycin ORF: bp 5147-5962
Expression System
Mammalian
Expression Method
Constitutive, Stable/Transient
Promoter
CMV
Sequencing Primers
T7 - 5' TAATACGACTCACTATAGGG 3'
BGH - 5' TAGAAGGCACAGTCGAGG 3'
Vector Size
6104 bp
Vector Sequence
1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTGCACTCT CAGTACAATC 51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT 101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG 151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG 201 CTGCTTCGCG AGTACATTTA TATTGGCTCA TGTCCAATAT GACCGCCATG 251 TTGACATTGA TTATTGACTA GTTATTAATA GTAATCAATT ACGGGGTCAT 301 TAGTTCATAG CCCATATATG GAGTTCCGCG TTACATAACT TACGGTAAAT 351 GGCCCGCCTG GCTGACCGCC CAACGACCCC CGCCCATTGA CGTCAATAAT 401 GACGTATGTT CCCATAGTAA CGCCAATAGG GACTTTCCAT TGACGTCAAT 451 GGGTGGAGTA TTTACGGTAA ACTGCCCACT TGGCAGTACA TCAAGTGTAT 501 CATATGCCAA GTCCGCCCCC TATTGACGTC AATGACGGTA AATGGCCCGC 551 CTGGCATTAT GCCCAGTACA TGACCTTACG GGACTTTCCT ACTTGGCAGT 601 ACATCTACGT ATTAGTCATC GCTATTACCA TGGTGATGCG GTTTTGGCAG 651 TACACCAATG GGCGTGGATA GCGGTTTGAC TCACGGGGAT TTCCAAGTCT 701 CCACCCCATT GACGTCAATG GGAGTTTGTT TTGGCACCAA AATCAACGGG 751 ACTTTCCAAA ATGTCGTAAT AACCCCGCCC CGTTGACGCA AATGGGCGGT 801 AGGCGTGTAC GGTGGGAGGT CTATATAAGC AGAGCTCGTT TAGTGAACCG 851 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTTGG 901 GCTCGCGGTT GAGGACAAAC TCTTCGCGGT CTTTCCAGTA CTCTTGGATC 951 GGAAACCCGT CGGCCTCCGA ACGGTACTCC GCCACCGAGG GACCTGAGCG 1001 AGTCCGCATC GACCGGATCG GAAAACCTCT CGAGAAAGGC GTCTAACCAG 1051 TCACAGTCGC AAGGTAGGCT GAGCACCGTG GCGGGCGGCA GCGGGTGGCG 1101 GTCGGGGTTG TTTCTGGCGG AGGTGCTGCT GATGATGTAA TTAAAGTAGG 1151 CGGTCTTGAG ACGGCGGATG GTCGAGGTGA GGTGTGGGTT TAGTGAACCG 1201 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTCAG 1251 GCTTGAGATC CAGCTGTTGG GGTGAGTACT CCCTCTCAAA AGCGGGCATT 1301 ACTTCTGCGC TAAGATTGTC AGTTTCCAAA AACGAGGAGG ATTTGATATT 1351 CACCTGGCCC GATCTGGCCA TACACTTGAG TGACAATGAC ATCCACTTTG 1401 CCTTTCTCTC CACAGGTGTC CACTCCCAGG TCCAAGTTTA AACTTTAATA 1451 CGACTCACTA TAGGGGCCGC CACCAAGCTT GGTACCATGG AGCAGAAACT 1501 CATCTCAGAA GAGGATCTGG GTGGAGGCGG TAGCGCTGCT AGCGGATCCG 1551 TTAACCTTAA GACCGGTGAT ATCATCGATT AAACTCGAGT CTAGAGCGGC 1601 CGCCGAATTC GGGCCCGTTT AAACCCGCTG ATCAGCCTCG ACTGTGCCTT 1651 CTAGTTGCCA GCCATCTGTT GTTTGCCCCT CCCCCGTGCC TTCCTTGACC 1701 CTGGAAGGTG CCACTCCCAC TGTCCTTTCC TAATAAAATG AGGAAATTGC 1751 ATCGCATTGT CTGAGTAGGT GTCATTCTAT TCTGGGGGGT GGGGTGGGGC 1801 AGGACAGCAA GGGGGAGGAT TGGGAAGACA ATAGCAGGCA TGCTGGGGAT 1851 GCGGTGGGCT CTATGGCTTC TGAGGCGGAA AGAACCAGCT GGGGCTCTAG 1901 GGGGTATCCC CACGCGCCCT GTAGCGGCGC ATTAAGCGCG GCGGGTGTGG 1951 TGGTTACGCG CAGCGTGACC GCTACACTTG CCAGCGCCCT AGCGCCCGCT 2001 CCTTTCGCTT TCTTCCCTTC CTTTCTCGCC ACGTTCGCAG GCTTTCCCCG 2051 TCAAGCTCTA AATCGGGGGC TCCCTTTAGG GTTCCGATTT AGTGCTTTAC 2101 GGCACCTCGA CCCCAAAAAA CTTGATTAGG GTGATGGTTC ACGTAGTGGG 2151 CCATCGCCCT GATAGACGGT TTTTCGCCCT TTGACGTTGG AGTCCACGTT 2201 CTTTAATAGT GGACTCTTGT TCCAAACTGG AACAACACTC AACCCTATCT 2251 CGGTCTATTC TTTTGATTTA TAAGGGATTT TGCCGATTTC GGCCTATTGG 2301 TTAAAAAATG AGCTGATTTA ACAAAAATTT AACGCGAATT AATTCTGTGG 2351 AATGTGTGTC AGTTAGGGTG TGGAAAGTCC CCAGGCTCCC CAGCAGGCAG 2401 AAGTATGCAA AGCATGCATC TCAATTAGTC AGCAACCAGG TGTGGAAAGT 2451 CCCCAGGCTC CCCAGCAGGC AGAAGTATGC AAAGCATGCA TCTCAATTAG 2501 TCAGCAACCA TAGTCCCGCC CCTAACTCCG CCCATCCCGC CCCTAACTCC 2551 GCCCAGTTCC GCCCATTCTC CGCCCCATGG CTGACTAATT TTTTTTATTT 2601 ATGCAGAGGC CGAGGCCGCC TCTGCCTCTG AGCTATTCCA GAAGTAGTGA 2651 GGAGGCTTTT TTGGAGGCCT AGGCTTTTGC AAAAAGCTCT CGGGAGCTTG 2701 TATATCCATT TTCGGATCTG ATCAGCACGT GATGAAAAAG CCTGAACTCA 2751 CCGCGACGTC TGTCGAGAAG TTTCTGATCG AAAAGTTCGA CAGCGTCTCC 2801 GACCTGATGC AGCTCTCGGA GGGCGAAGAA TCTCGTGCTT TCAGCTTCGA 2851 TGTAGGAGGG CGTGGATATG TCCTGCGGGT AAATAGCTGC GCCGATGGTT 2901 TCTACAAAGA TCGTTATGTT TATCGGCACT TTGCATCGGC CGCGCTCCCG 2951 ATTCCGGAAG TGCTTGACAT TGGGGAATTC AGCGAGAGCC TGACCTATTG 3001 CATCTCCCGC CGTGCACAGG GTGTCACGTT GCAAGACCTG CCTGAAACCG 3051 AACTGCCCGC TGTTCTGCAG CCGGTCGCGG AGGCCATGGA TGCGATCGCT 3101 GCGGCCGATC TTAGCCAGAC GAGCGGGTTC GGCCCATTCG GACCGCAAGG 3151 AATCGGTCAA TACACTACAT GGCGTGATTT CATATGCGCG ATTGCTGATC 3201 CCCATGTGTA TCACTGGCAA ACTGTGATGG ACGACACCGT CAGTGCGTCC 3251 GTCGCGCAGG CTCTCGATGA GCTGATGCTT TGGGCCGAGG ACTGCCCCGA 3301 AGTCCGGCAC CTCGTGCACG CGGATTTCGG CTCCAACAAT GTCCTGACGG 3351 ACAATGGCCG CATAACAGCG GTCATTGACT GGAGCGAGGC GATGTTCGGG 3401 GATTCCCAAT ACGAGGTCGC CAACATCTTC TTCTGGAGGC CGTGGTTGGC 3451 TTGTATGGAG CAGCAGACGC GCTACTTCGA GCGGAGGCAT CCGGAGCTTG 3501 CAGGATCGCC GCGGCTCCGG GCGTATATGC TCCGCATTGG TCTTGACCAA 3551 CTCTATCAGA GCTTGGTTGA CGGCAATTTC GATGATGCAG CTTGGGCGCA 3601 GGGTCGATGC GACGCAATCG TCCGATCCGG AGCCGGGACT GTCGGGCGTA 3651 CACAAATCGC CCGCAGAAGC GCGGCCGTCT GGACCGATGG CTGTGTAGAA 3701 GTACTCGCCG ATAGTGGAAA CCGACGCCCC AGCACTCGTC CGAGGGCAAA 3751 GGAATAGCAC GTGCTACGAG ATTTCGATTC CACCGCCGCC TTCTATGAAA 3801 GGTTGGGCTT CGGAATCGTT TTCCGGGACG CTGGCTGGAT GATCCTCCAG 3851 CGCGGGGATC TCATGCTGGA GTTCTTCGCC CACCCCAACT TGTTTATTGC 3901 AGCTTATAAT GGTTACAAAT AAAGCAATAG CATCACAAAT TTCACAAATA 3951 AAGCATTTTT TTCACTGCAT TCTAGTTGTG GTTTGTCCAA ACTCATCAAT 4001 GTATCTTATC ATGTCTGTAT ACCGTCGACC TCTAGCTAGA GCTTGGCGTA 4051 ATCATGGTCA TAGCTGTTTC CTGTGTGAAA TTGTTATCCG CTCACAATTC 4101 CACACAACAT ACGAGCCGGA AGCATAAAGT GTAAAGCCTG GGGTGCCTAA 4151 TGAGTGAGCT AACTCACATT AATTGCGTTG CGCTCACTGC CCGCTTTCCA 4201 GTCGGGAAAC CTGTCGTGCC AGCTGCATTA ATGAATCGGC CAACGCGCGG 4251 GGAGAGGCGG TTTGCGTATT GGGCGCTCTT CCGCTTCCTC GCTCACTGAC 4301 TCGCTGCGCT CGGTCGTTCG GCTGCGGCGA GCGGTATCAG CTCACTCAAA 4351 GGCGGTAATA CGGTTATCCA CAGAATCAGG GGATAACGCA GGAAAGAACA 4401 TGTGAGCAAA AGGCCAGCAA AAGGCCAGGA ACCGTAAAAA GGCCGCGTTG 4451 CTGGCGTTTT TCCATAGGCT CCGCCCCCCT GACGAGCATC ACAAAAATCG 4501 ACGCTCAAGT CAGAGGTGGC GAAACCCGAC AGGACTATAA AGATACCAGG 4551 CGTTTCCCCC TGGAAGCTCC CTCGTGCGCT CTCCTGTTCC GACCCTGCCG 4601 CTTACCGGAT ACCTGTCCGC CTTTCTCCCT TCGGGAAGCG TGGCGCTTTC 4651 TCATAGCTCA CGCTGTAGGT ATCTCAGTTC GGTGTAGGTC GTTCGCTCCA 4701 AGCTGGGCTG TGTGCACGAA CCCCCCGTTC AGCCCGACCG CTGCGCCTTA 4751 TCCGGTAACT ATCGTCTTGA GTCCAACCCG GTAAGACACG ACTTATCGCC 4801 ACTGGCAGCA GCCACTGGTA ACAGGATTAG CAGAGCGAGG TATGTAGGCG 4851 GTGCTACAGA GTTCTTGAAG TGGTGGCCTA ACTACGGCTA CACTAGAAGA 4901 ACAGTATTTG GTATCTGCGC TCTGCTGAAG CCAGTTACCT TCGGAAAAAG 4951 AGTTGGTAGC TCTTGATCCG GCAAACAAAC CACCGCTGGT AGCGGTGGTT 5001 TTTTTGTTTG CAAGCAGCAG ATTACGCGCA GAAAAAAAGG ATCTCAAGAA 5051 GATCCTTTGA TCTTTTCTAC GGGGTCTGAG CGCGGAACCC CTATTTGTTT 5101 ATTTTTCTAA ATACATTCAA ATATGTATCC GCTCATGAAT TAATTCTTAG 5151 AAAAACTCAT CGAGCATCAA ATGAAACTGC AATTTATTCA TATCAGGATT 5201 ATCAATACCA TATTTTTGAA AAAGCCGTTT CTGTAATGAA GGAGAAAACT 5251 CACCGAGGCA GTTCCATAGG ATGGCAAGAT CCTGGTATCG GTCTGCGATT 5301 CCGACTCGTC CAACATCAAT ACAACCTATT AATTTCCCCT CGTCAAAAAT 5351 AAGGTTATCA AGTGAGAAAT CACCATGAGT GACGACTGAA TCCGGTGAGA 5401 ATGGCAAAAG TTTATGCATT TCTTTCCAGA CTTGTTCAAC AGGCCAGCCA 5451 TTACGCTCGT CATCAAAATC ACTCGCATCA ACCAAACCGT TATTCATTCG 5501 TGATTGCGCC TGAGCGAGAC GAAATACGCG ATCGCTGTTA AAAGGACAAT 5551 TACAAACAGG AATCGAATGC AACCGGCGCA GGAACACTGC CAGCGCATCA 5601 ACAATATTTT CACCTGAATC AGGATATTCT TCTAATACCT GGAATGCTGT 5651 TTTCCCAGGG ATCGCAGTGG TGAGTAACCA TGCATCATCA GGAGTACGGA 5701 TAAAATGCTT GATGGTCGGA AGAGGCATAA ATTCCGTCAG CCAGTTTAGT 5751 CTGACCATCT CATCTGTAAC ATCATTGGCA ACGCTACCTT TGCCATGTTT 5801 CAGAAACAAC TCTGGCGCAT CGGGCTTCCC ATACAATCGA TAGATTGTCG 5851 CACCTGATTG CCCGACATTA TCGCGAGCCC ATTTATACCC ATATAAATCA 5901 GCATCCATGT TGGAATTTAA TCGCGGCCTA GAGCAAGACG TTTCCCGTTG 5951 AATATGGCTC ATAACACCCC TTGTATTACT GTTTATGTAA GCAGACAGTT 6001 TTATTGTTCA TGACCAAAAT CCCTTAACGT GAGTTTTCGT TCCACTGAGC 6051 GTCAGACCCC GTAGAAATCC GCGCACATTT CCCCGAAAAG TGCCACCTGA 6101 CGTC
Vector Tag
Myc, N-terminus
Tag Information
A Myc-tag is a polypeptide protein tag derived from the c-Myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed proteins from wild type proteins expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits. A Myc-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a Myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting. The peptide sequence of the Myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.
Usage Summary
Most commercially available competent cells are appropriate for propagation of the plasmid, e.g. TOP10, DH5a, and TOP10F’.
About MTMR12
Q9C0I1 AB051469 BAB21773.1

Publications (0)

Customer Reviews (0)

Images

MTMR12 NucleicAcid

MTMR12 NucleicAcid

MTMR12 NucleicAcid

MTMR12 NucleicAcid

Requested From: United States
Date Requested: 8/6/2020