Products
Services
Research Areas
COVID-19
Resources
Contact Us
Distributors
Login
Quick Order
Cart
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Services
Immunohistochemistry Services

Work with LifeSpan to design a custom immunohistochemistry to address your specific biological question. Outsource the entire localization process without having to worry about finding and characterizing target specific antibodies, sourcing and validating difficult-to-find tissues, and having the ability to interpret the resulting immunostaining in relation to complex human pathologies.

TCR Screening Services

Test your therapeutic antibodies in immunohistochemistry against a broad panel of normal frozen human tissue types in order to determine potential unintended binding. Our non-GLP TCR services are designed on the FDA recommendation outlined in their "Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use".

Research Areas
Cell Cycle Pathways
Protein Family And Group
Infectious Disease
Contact Us
LSBio
2401 Fourth Avenue Suite 900
Seattle WA 98121
Phone:
866-819-4732 (Toll Free North America
206-374-1102 (International)
Fax:
866-206-6909 (Toll Free North America)
206-577-4565 (International)
How To Buy - Details about how to buy our products.
Orders@LSBio.com - To submit a new order.
Customer.Support@LSBio.com - To submit questions about existing orders, pricing, availability, bulk quotes, froforma invoice requests, or other billing issues.
Technical.Support@LSBio.com - To request technical information about an LSBio product or its applications
Sales@LSBio.com - To request information about fee-for-service contract IHC studies, IHC reports, distribution agreements, or general business development.
Worldwide Distributors List - To find your local distributor if you're not within the United States.
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Catalog Number Size Price
LS-N55429-1 1 Each $345 
MMRN1 NucleicAcid

Human MMRN1 Expression-Ready ORF Clone (pCMV3-C-DDK (Flag)) LS-N55429

Human MMRN1 Expression-Ready ORF Clone (pCMV3-C-DDK (Flag)) LS-N55429

Description:
Human MMRN1 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-C-DDK (Flag, with C-Terminal DDK (Flag tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-C-DDK (Flag)
Other formats:
Price
Catalog Number
$345 
LS-N55429-1
1 Each

Estimated Shipping: 20 Business Days
Toll Free North America
866-819-4732
For Research Use Only

Overview

Description:
Human MMRN1 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-C-DDK (Flag, with C-Terminal DDK (Flag tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-C-DDK (Flag)
Other formats:

Specifications

Type
Expression-Ready ORF Clone
Target
MMRN1
Synonyms
MMRN1 | Endothelial cell multimerin | EMILIN4 | ECM | EMILIN-4 | GPIa* | Multimerin | Prepromultimerin | Glycoprotein Ia* | MMRN | Multimerin 1 | Multimerin-1
Species
Human
Insert Size
3687 bp
Cloning Enzymes Used
This construct is not yet assembled.
Presentation
Lyophilized
Reconstitution
  • Centrifuge at 5,000 x g for 5 minutes.
  • Carefully open the tube and add 100 µl of sterile water to dissolve the DNA.
  • Close the tube and incubate for 10 minutes at room temperature.
  • Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5,000 x g.
  • Store the plasmid at -20°C.
Storage
Store lyophilized at room temperature for up to three months.
Validation
The insert is confirmed by full-length sequencing with the sequencing primers listed.
Restrictions
For research use only. Intended for use by laboratory professionals.
Guarantee
This Expression-Ready ORF Clone carries the LSBio 100% Guarantee.
LSBio Guarantee
Vector
pCMV3-C-DDK (Flag)
Vector Type
Expression Vector
Vector Information
All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
  • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
  • Hygromycin resistance gene for selection in mammalian cell lines.
  • A Kozak consensus sequence to enhance mammalian expression.
CMV promoter: bp 250-837
Enhancer: bp 838-1445
SV40 early promoter: bp 2399-2768
Hygromycin ORF: bp 2786-3811
pUC origin: bp 4454-5127
Kanamycin ORF: bp 5201-6016
Expression System
Mammalian
Expression Method
Constitutive, Stable/Transient
Promoter
CMV
Sequencing Primers
T7 - 5' TAATACGACTCACTATAGGG 3'
BGH - 5' TAGAAGGCACAGTCGAGG 3'
Vector Size
6158 bp
Vector Sequence
1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTGCACTCT CAGTACAATC 51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT 101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG 151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG 201 CTGCTTCGCG AGTACATTTA TATTGGCTCA TGTCCAATAT GACCGCCATG 251 TTGACATTGA TTATTGACTA GTTATTAATA GTAATCAATT ACGGGGTCAT 301 TAGTTCATAG CCCATATATG GAGTTCCGCG TTACATAACT TACGGTAAAT 351 GGCCCGCCTG GCTGACCGCC CAACGACCCC CGCCCATTGA CGTCAATAAT 401 GACGTATGTT CCCATAGTAA CGCCAATAGG GACTTTCCAT TGACGTCAAT 451 GGGTGGAGTA TTTACGGTAA ACTGCCCACT TGGCAGTACA TCAAGTGTAT 501 CATATGCCAA GTCCGCCCCC TATTGACGTC AATGACGGTA AATGGCCCGC 551 CTGGCATTAT GCCCAGTACA TGACCTTACG GGACTTTCCT ACTTGGCAGT 601 ACATCTACGT ATTAGTCATC GCTATTACCA TGGTGATGCG GTTTTGGCAG 651 TACACCAATG GGCGTGGATA GCGGTTTGAC TCACGGGGAT TTCCAAGTCT 701 CCACCCCATT GACGTCAATG GGAGTTTGTT TTGGCACCAA AATCAACGGG 751 ACTTTCCAAA ATGTCGTAAT AACCCCGCCC CGTTGACGCA AATGGGCGGT 801 AGGCGTGTAC GGTGGGAGGT CTATATAAGC AGAGCTCGTT TAGTGAACCG 851 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTTGG 901 GCTCGCGGTT GAGGACAAAC TCTTCGCGGT CTTTCCAGTA CTCTTGGATC 951 GGAAACCCGT CGGCCTCCGA ACGGTACTCC GCCACCGAGG GACCTGAGCG 1001 AGTCCGCATC GACCGGATCG GAAAACCTCT CGAGAAAGGC GTCTAACCAG 1051 TCACAGTCGC AAGGTAGGCT GAGCACCGTG GCGGGCGGCA GCGGGTGGCG 1101 GTCGGGGTTG TTTCTGGCGG AGGTGCTGCT GATGATGTAA TTAAAGTAGG 1151 CGGTCTTGAG ACGGCGGATG GTCGAGGTGA GGTGTGGGTT TAGTGAACCG 1201 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTCAG 1251 GCTTGAGATC CAGCTGTTGG GGTGAGTACT CCCTCTCAAA AGCGGGCATT 1301 ACTTCTGCGC TAAGATTGTC AGTTTCCAAA AACGAGGAGG ATTTGATATT 1351 CACCTGGCCC GATCTGGCCA TACACTTGAG TGACAATGAC ATCCACTTTG 1401 CCTTTCTCTC CACAGGTGTC CACTCCCAGG TCCAAGTTTA AACTTTAATA 1451 CGACTCACTA TAGGGGCCGC CACCAAGCTT GGTACCGCTA GCGGATCCGT 1501 TAACCTTAAG ACCGGTATGG GCTGGTCCTG CATCATCCTG TTCCTCGTGG 1551 CGACCGCGAC CGGGGTCCAC AGCGATATCA TCGATAGCGC TCCCGGGGGT 1601 GGAGGCTCTG ATTACAAGGA TGACGACGAT AAGTAAACTC GAGTCTAGAG 1651 CGGCCGCCGA ATTCGGGCCC GTTTAAACCC GCTGATCAGC CTCGACTGTG 1701 CCTTCTAGTT GCCAGCCATC TGTTGTTTGC CCCTCCCCCG TGCCTTCCTT 1751 GACCCTGGAA GGTGCCACTC CCACTGTCCT TTCCTAATAA AATGAGGAAA 1801 TTGCATCGCA TTGTCTGAGT AGGTGTCATT CTATTCTGGG GGGTGGGGTG 1851 GGGCAGGACA GCAAGGGGGA GGATTGGGAA GACAATAGCA GGCATGCTGG 1901 GGATGCGGTG GGCTCTATGG CTTCTGAGGC GGAAAGAACC AGCTGGGGCT 1951 CTAGGGGGTA TCCCCACGCG CCCTGTAGCG GCGCATTAAG CGCGGCGGGT 2001 GTGGTGGTTA CGCGCAGCGT GACCGCTACA CTTGCCAGCG CCCTAGCGCC 2051 CGCTCCTTTC GCTTTCTTCC CTTCCTTTCT CGCCACGTTC GCAGGCTTTC 2101 CCCGTCAAGC TCTAAATCGG GGGCTCCCTT TAGGGTTCCG ATTTAGTGCT 2151 TTACGGCACC TCGACCCCAA AAAACTTGAT TAGGGTGATG GTTCACGTAG 2201 TGGGCCATCG CCCTGATAGA CGGTTTTTCG CCCTTTGACG TTGGAGTCCA 2251 CGTTCTTTAA TAGTGGACTC TTGTTCCAAA CTGGAACAAC ACTCAACCCT 2301 ATCTCGGTCT ATTCTTTTGA TTTATAAGGG ATTTTGCCGA TTTCGGCCTA 2351 TTGGTTAAAA AATGAGCTGA TTTAACAAAA ATTTAACGCG AATTAATTCT 2401 GTGGAATGTG TGTCAGTTAG GGTGTGGAAA GTCCCCAGGC TCCCCAGCAG 2451 GCAGAAGTAT GCAAAGCATG CATCTCAATT AGTCAGCAAC CAGGTGTGGA 2501 AAGTCCCCAG GCTCCCCAGC AGGCAGAAGT ATGCAAAGCA TGCATCTCAA 2551 TTAGTCAGCA ACCATAGTCC CGCCCCTAAC TCCGCCCATC CCGCCCCTAA 2601 CTCCGCCCAG TTCCGCCCAT TCTCCGCCCC ATGGCTGACT AATTTTTTTT 2651 ATTTATGCAG AGGCCGAGGC CGCCTCTGCC TCTGAGCTAT TCCAGAAGTA 2701 GTGAGGAGGC TTTTTTGGAG GCCTAGGCTT TTGCAAAAAG CTCTCGGGAG 2751 CTTGTATATC CATTTTCGGA TCTGATCAGC ACGTGATGAA AAAGCCTGAA 2801 CTCACCGCGA CGTCTGTCGA GAAGTTTCTG ATCGAAAAGT TCGACAGCGT 2851 CTCCGACCTG ATGCAGCTCT CGGAGGGCGA AGAATCTCGT GCTTTCAGCT 2901 TCGATGTAGG AGGGCGTGGA TATGTCCTGC GGGTAAATAG CTGCGCCGAT 2951 GGTTTCTACA AAGATCGTTA TGTTTATCGG CACTTTGCAT CGGCCGCGCT 3001 CCCGATTCCG GAAGTGCTTG ACATTGGGGA ATTCAGCGAG AGCCTGACCT 3051 ATTGCATCTC CCGCCGTGCA CAGGGTGTCA CGTTGCAAGA CCTGCCTGAA 3101 ACCGAACTGC CCGCTGTTCT GCAGCCGGTC GCGGAGGCCA TGGATGCGAT 3151 CGCTGCGGCC GATCTTAGCC AGACGAGCGG GTTCGGCCCA TTCGGACCGC 3201 AAGGAATCGG TCAATACACT ACATGGCGTG ATTTCATATG CGCGATTGCT 3251 GATCCCCATG TGTATCACTG GCAAACTGTG ATGGACGACA CCGTCAGTGC 3301 GTCCGTCGCG CAGGCTCTCG ATGAGCTGAT GCTTTGGGCC GAGGACTGCC 3351 CCGAAGTCCG GCACCTCGTG CACGCGGATT TCGGCTCCAA CAATGTCCTG 3401 ACGGACAATG GCCGCATAAC AGCGGTCATT GACTGGAGCG AGGCGATGTT 3451 CGGGGATTCC CAATACGAGG TCGCCAACAT CTTCTTCTGG AGGCCGTGGT 3501 TGGCTTGTAT GGAGCAGCAG ACGCGCTACT TCGAGCGGAG GCATCCGGAG 3551 CTTGCAGGAT CGCCGCGGCT CCGGGCGTAT ATGCTCCGCA TTGGTCTTGA 3601 CCAACTCTAT CAGAGCTTGG TTGACGGCAA TTTCGATGAT GCAGCTTGGG 3651 CGCAGGGTCG ATGCGACGCA ATCGTCCGAT CCGGAGCCGG GACTGTCGGG 3701 CGTACACAAA TCGCCCGCAG AAGCGCGGCC GTCTGGACCG ATGGCTGTGT 3751 AGAAGTACTC GCCGATAGTG GAAACCGACG CCCCAGCACT CGTCCGAGGG 3801 CAAAGGAATA GCACGTGCTA CGAGATTTCG ATTCCACCGC CGCCTTCTAT 3851 GAAAGGTTGG GCTTCGGAAT CGTTTTCCGG GACGCTGGCT GGATGATCCT 3901 CCAGCGCGGG GATCTCATGC TGGAGTTCTT CGCCCACCCC AACTTGTTTA 3951 TTGCAGCTTA TAATGGTTAC AAATAAAGCA ATAGCATCAC AAATTTCACA 4001 AATAAAGCAT TTTTTTCACT GCATTCTAGT TGTGGTTTGT CCAAACTCAT 4051 CAATGTATCT TATCATGTCT GTATACCGTC GACCTCTAGC TAGAGCTTGG 4101 CGTAATCATG GTCATAGCTG TTTCCTGTGT GAAATTGTTA TCCGCTCACA 4151 ATTCCACACA ACATACGAGC CGGAAGCATA AAGTGTAAAG CCTGGGGTGC 4201 CTAATGAGTG AGCTAACTCA CATTAATTGC GTTGCGCTCA CTGCCCGCTT 4251 TCCAGTCGGG AAACCTGTCG TGCCAGCTGC ATTAATGAAT CGGCCAACGC 4301 GCGGGGAGAG GCGGTTTGCG TATTGGGCGC TCTTCCGCTT CCTCGCTCAC 4351 TGACTCGCTG CGCTCGGTCG TTCGGCTGCG GCGAGCGGTA TCAGCTCACT 4401 CAAAGGCGGT AATACGGTTA TCCACAGAAT CAGGGGATAA CGCAGGAAAG 4451 AACATGTGAG CAAAAGGCCA GCAAAAGGCC AGGAACCGTA AAAAGGCCGC 4501 GTTGCTGGCG TTTTTCCATA GGCTCCGCCC CCCTGACGAG CATCACAAAA 4551 ATCGACGCTC AAGTCAGAGG TGGCGAAACC CGACAGGACT ATAAAGATAC 4601 CAGGCGTTTC CCCCTGGAAG CTCCCTCGTG CGCTCTCCTG TTCCGACCCT 4651 GCCGCTTACC GGATACCTGT CCGCCTTTCT CCCTTCGGGA AGCGTGGCGC 4701 TTTCTCATAG CTCACGCTGT AGGTATCTCA GTTCGGTGTA GGTCGTTCGC 4751 TCCAAGCTGG GCTGTGTGCA CGAACCCCCC GTTCAGCCCG ACCGCTGCGC 4801 CTTATCCGGT AACTATCGTC TTGAGTCCAA CCCGGTAAGA CACGACTTAT 4851 CGCCACTGGC AGCAGCCACT GGTAACAGGA TTAGCAGAGC GAGGTATGTA 4901 GGCGGTGCTA CAGAGTTCTT GAAGTGGTGG CCTAACTACG GCTACACTAG 4951 AAGAACAGTA TTTGGTATCT GCGCTCTGCT GAAGCCAGTT ACCTTCGGAA 5001 AAAGAGTTGG TAGCTCTTGA TCCGGCAAAC AAACCACCGC TGGTAGCGGT 5051 GGTTTTTTTG TTTGCAAGCA GCAGATTACG CGCAGAAAAA AAGGATCTCA 5101 AGAAGATCCT TTGATCTTTT CTACGGGGTC TGAGCGCGGA ACCCCTATTT 5151 GTTTATTTTT CTAAATACAT TCAAATATGT ATCCGCTCAT GAATTAATTC 5201 TTAGAAAAAC TCATCGAGCA TCAAATGAAA CTGCAATTTA TTCATATCAG 5251 GATTATCAAT ACCATATTTT TGAAAAAGCC GTTTCTGTAA TGAAGGAGAA 5301 AACTCACCGA GGCAGTTCCA TAGGATGGCA AGATCCTGGT ATCGGTCTGC 5351 GATTCCGACT CGTCCAACAT CAATACAACC TATTAATTTC CCCTCGTCAA 5401 AAATAAGGTT ATCAAGTGAG AAATCACCAT GAGTGACGAC TGAATCCGGT 5451 GAGAATGGCA AAAGTTTATG CATTTCTTTC CAGACTTGTT CAACAGGCCA 5501 GCCATTACGC TCGTCATCAA AATCACTCGC ATCAACCAAA CCGTTATTCA 5551 TTCGTGATTG CGCCTGAGCG AGACGAAATA CGCGATCGCT GTTAAAAGGA 5601 CAATTACAAA CAGGAATCGA ATGCAACCGG CGCAGGAACA CTGCCAGCGC 5651 ATCAACAATA TTTTCACCTG AATCAGGATA TTCTTCTAAT ACCTGGAATG 5701 CTGTTTTCCC AGGGATCGCA GTGGTGAGTA ACCATGCATC ATCAGGAGTA 5751 CGGATAAAAT GCTTGATGGT CGGAAGAGGC ATAAATTCCG TCAGCCAGTT 5801 TAGTCTGACC ATCTCATCTG TAACATCATT GGCAACGCTA CCTTTGCCAT 5851 GTTTCAGAAA CAACTCTGGC GCATCGGGCT TCCCATACAA TCGATAGATT 5901 GTCGCACCTG ATTGCCCGAC ATTATCGCGA GCCCATTTAT ACCCATATAA 5951 ATCAGCATCC ATGTTGGAAT TTAATCGCGG CCTAGAGCAA GACGTTTCCC 6001 GTTGAATATG GCTCATAACA CCCCTTGTAT TACTGTTTAT GTAAGCAGAC 6051 AGTTTTATTG TTCATGACCA AAATCCCTTA ACGTGAGTTT TCGTTCCACT 6101 GAGCGTCAGA CCCCGTAGAA ATCCGCGCAC ATTTCCCCGA AAAGTGCCAC 6151 CTGACGTC
Vector Tag
DDK (Flag), C-terminus
Tag Information
DDK (Flag)-tag, or DDK (Flag) octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed proteins from wild-type proteins expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits. A DDK (Flag)-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a DDK (Flag)-tag to this protein allows one to follow the protein with an antibody against the DDK (Flag) sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis. The peptide sequence of the DDK (Flag)-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine-tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g. M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g. M2) are position-insensitive.
Usage Summary
Most commercially available competent cells are appropriate for propagation of the plasmid, e.g. TOP10, DH5a, and TOP10F’.
About MMRN1
Q13201 NM_007351 NP_031377.2

Publications (0)

Customer Reviews (0)

Images

MMRN1 NucleicAcid

MMRN1 NucleicAcid

MMRN1 NucleicAcid

MMRN1 NucleicAcid

Requested From: United States
Date Requested: 8/10/2020