Products
Services
Research Areas
COVID-19
Resources
Contact Us
Distributors
Login
Quick Order
Cart
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Services
Immunohistochemistry Services

Work with LifeSpan to design a custom immunohistochemistry to address your specific biological question. Outsource the entire localization process without having to worry about finding and characterizing target specific antibodies, sourcing and validating difficult-to-find tissues, and having the ability to interpret the resulting immunostaining in relation to complex human pathologies.

TCR Screening Services

Test your therapeutic antibodies in immunohistochemistry against a broad panel of normal frozen human tissue types in order to determine potential unintended binding. Our non-GLP TCR services are designed on the FDA recommendation outlined in their "Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use".

Research Areas
Cell Cycle Pathways
Protein Family And Group
Infectious Disease
Contact Us
LSBio
2401 Fourth Avenue Suite 900
Seattle WA 98121
Phone:
866-819-4732 (Toll Free North America
206-374-1102 (International)
Fax:
866-206-6909 (Toll Free North America)
206-577-4565 (International)
How To Buy - Details about how to buy our products.
Orders@LSBio.com - To submit a new order.
Customer.Support@LSBio.com - To submit questions about existing orders, pricing, availability, bulk quotes, froforma invoice requests, or other billing issues.
Technical.Support@LSBio.com - To request technical information about an LSBio product or its applications
Sales@LSBio.com - To request information about fee-for-service contract IHC studies, IHC reports, distribution agreements, or general business development.
Worldwide Distributors List - To find your local distributor if you're not within the United States.
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Catalog Number Size Price
LS-N55716-1 1 Each $196 
GNRH2 NucleicAcid

Human GNRH2 Expression-Ready ORF Clone (pCMV3-SP-N-DDK (Flag)) LS-N55716

Human GNRH2 Expression-Ready ORF Clone (pCMV3-SP-N-DDK (Flag)) LS-N55716

Description:
Human GNRH2 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-SP-N-DDK (Flag, with N-Terminal DDK (Flag tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-SP-N-DDK (Flag)
Other formats:
Price
Catalog Number
$196 
LS-N55716-1
1 Each

Estimated Shipping: 20 Business Days
Toll Free North America
866-819-4732
For Research Use Only

Overview

Description:
Human GNRH2 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-SP-N-DDK (Flag, with N-Terminal DDK (Flag tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-SP-N-DDK (Flag)
Other formats:

Specifications

Type
Expression-Ready ORF Clone
Target
GNRH2
Synonyms
GNRH2 | GnRH-II | LH-RHII | Luliberin II | Progonadoliberin-2 | Progonadoliberin II
Species
Human
Insert Size
363 bp
Cloning Enzymes Used
This construct is not yet assembled.
Presentation
Lyophilized
Reconstitution
  • Centrifuge at 5,000 x g for 5 minutes.
  • Carefully open the tube and add 100 µl of sterile water to dissolve the DNA.
  • Close the tube and incubate for 10 minutes at room temperature.
  • Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5,000 x g.
  • Store the plasmid at -20°C.
Storage
Store lyophilized at room temperature for up to three months.
Validation
The insert is confirmed by full-length sequencing with the sequencing primers listed.
Restrictions
For research use only. Intended for use by laboratory professionals.
Guarantee
This Expression-Ready ORF Clone carries the LSBio 100% Guarantee.
LSBio Guarantee
Vector
pCMV3-SP-N-DDK (Flag)
Vector Type
Expression Vector
Vector Information
All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
  • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
  • Hygromycin resistance gene for selection in mammalian cell lines.
  • A Kozak consensus sequence to enhance mammalian expression.
This vector is suitable for secretory and membrane protein expression.
CMV promoter: bp 250-837
Enhancer: bp 838-1445
SV40 early promoter: bp 2384-2753
Hygromycin ORF: bp 2771-3793
pUC origin: bp 4439-5112
Kanamycin ORF: bp 5186-6001
Expression System
Mammalian
Expression Method
Constitutive, Stable/Transient
Promoter
CMV
Sequencing Primers
T7 - 5' TAATACGACTCACTATAGGG 3'
BGH - 5' TAGAAGGCACAGTCGAGG 3'
Vector Size
6143 bp
Vector Sequence
1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTGCACTCT CAGTACAATC 51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT 101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG 151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG 201 CTGCTTCGCG AGTACATTTA TATTGGCTCA TGTCCAATAT GACCGCCATG 251 TTGACATTGA TTATTGACTA GTTATTAATA GTAATCAATT ACGGGGTCAT 301 TAGTTCATAG CCCATATATG GAGTTCCGCG TTACATAACT TACGGTAAAT 351 GGCCCGCCTG GCTGACCGCC CAACGACCCC CGCCCATTGA CGTCAATAAT 401 GACGTATGTT CCCATAGTAA CGCCAATAGG GACTTTCCAT TGACGTCAAT 451 GGGTGGAGTA TTTACGGTAA ACTGCCCACT TGGCAGTACA TCAAGTGTAT 501 CATATGCCAA GTCCGCCCCC TATTGACGTC AATGACGGTA AATGGCCCGC 551 CTGGCATTAT GCCCAGTACA TGACCTTACG GGACTTTCCT ACTTGGCAGT 601 ACATCTACGT ATTAGTCATC GCTATTACCA TGGTGATGCG GTTTTGGCAG 651 TACACCAATG GGCGTGGATA GCGGTTTGAC TCACGGGGAT TTCCAAGTCT 701 CCACCCCATT GACGTCAATG GGAGTTTGTT TTGGCACCAA AATCAACGGG 751 ACTTTCCAAA ATGTCGTAAT AACCCCGCCC CGTTGACGCA AATGGGCGGT 801 AGGCGTGTAC GGTGGGAGGT CTATATAAGC AGAGCTCGTT TAGTGAACCG 851 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTTGG 901 GCTCGCGGTT GAGGACAAAC TCTTCGCGGT CTTTCCAGTA CTCTTGGATC 951 GGAAACCCGT CGGCCTCCGA ACGGTACTCC GCCACCGAGG GACCTGAGCG 1001 AGTCCGCATC GACCGGATCG GAAAACCTCT CGAGAAAGGC GTCTAACCAG 1051 TCACAGTCGC AAGGTAGGCT GAGCACCGTG GCGGGCGGCA GCGGGTGGCG 1101 GTCGGGGTTG TTTCTGGCGG AGGTGCTGCT GATGATGTAA TTAAAGTAGG 1151 CGGTCTTGAG ACGGCGGATG GTCGAGGTGA GGTGTGGGTT TAGTGAACCG 1201 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTCAG 1251 GCTTGAGATC CAGCTGTTGG GGTGAGTACT CCCTCTCAAA AGCGGGCATT 1301 ACTTCTGCGC TAAGATTGTC AGTTTCCAAA AACGAGGAGG ATTTGATATT 1351 CACCTGGCCC GATCTGGCCA TACACTTGAG TGACAATGAC ATCCACTTTG 1401 CCTTTCTCTC CACAGGTGTC CACTCCCAGG TCCAAGTTTA AACTTTAATA 1451 CGACTCACTA TAGGGGCCGC CACCAAGCTT GGTACCATGC CACTGCTGCT 1501 CTTGCTGCCT CTGCTTTGGG CTGGAGCTCT GGCTGATTAC AAGGATGACG 1551 ACGATAAGGG TGGAGGCGGT AGCGCTGCTA GCGGATCCGT TAACCTTAAG 1601 ACCGGTGATA TCATCGATTA AACTCGAGTC TAGAGCGGCC GCCGAATTCG 1651 GGCCCGTTTA AACCCGCTGA TCAGCCTCGA CTGTGCCTTC TAGTTGCCAG 1701 CCATCTGTTG TTTGCCCCTC CCCCGTGCCT TCCTTGACCC TGGAAGGTGC 1751 CACTCCCACT GTCCTTTCCT AATAAAATGA GGAAATTGCA TCGCATTGTC 1801 TGAGTAGGTG TCATTCTATT CTGGGGGGTG GGGTGGGGCA GGACAGCAAG 1851 GGGGAGGATT GGGAAGACAA TAGCAGGCAT GCTGGGGATG CGGTGGGCTC 1901 TATGGCTTCT GAGGCGGAAA GAACCAGCTG GGGCTCTAGG GGGTATCCCC 1951 ACGCGCCCTG TAGCGGCGCA TTAAGCGCGG CGGGTGTGGT GGTTACGCGC 2001 AGCGTGACCG CTACACTTGC CAGCGCCCTA GCGCCCGCTC CTTTCGCTTT 2051 CTTCCCTTCC TTTCTCGCCA CGTTCGCAGG CTTTCCCCGT CAAGCTCTAA 2101 ATCGGGGGCT CCCTTTAGGG TTCCGATTTA GTGCTTTACG GCACCTCGAC 2151 CCCAAAAAAC TTGATTAGGG TGATGGTTCA CGTAGTGGGC CATCGCCCTG 2201 ATAGACGGTT TTTCGCCCTT TGACGTTGGA GTCCACGTTC TTTAATAGTG 2251 GACTCTTGTT CCAAACTGGA ACAACACTCA ACCCTATCTC GGTCTATTCT 2301 TTTGATTTAT AAGGGATTTT GCCGATTTCG GCCTATTGGT TAAAAAATGA 2351 GCTGATTTAA CAAAAATTTA ACGCGAATTA ATTCTGTGGA ATGTGTGTCA 2401 GTTAGGGTGT GGAAAGTCCC CAGGCTCCCC AGCAGGCAGA AGTATGCAAA 2451 GCATGCATCT CAATTAGTCA GCAACCAGGT GTGGAAAGTC CCCAGGCTCC 2501 CCAGCAGGCA GAAGTATGCA AAGCATGCAT CTCAATTAGT CAGCAACCAT 2551 AGTCCCGCCC CTAACTCCGC CCATCCCGCC CCTAACTCCG CCCAGTTCCG 2601 CCCATTCTCC GCCCCATGGC TGACTAATTT TTTTTATTTA TGCAGAGGCC 2651 GAGGCCGCCT CTGCCTCTGA GCTATTCCAG AAGTAGTGAG GAGGCTTTTT 2701 TGGAGGCCTA GGCTTTTGCA AAAAGCTCTC GGGAGCTTGT ATATCCATTT 2751 TCGGATCTGA TCAGCACGTG ATGAAAAAGC CTGAACTCAC CGCGACGTCT 2801 GTCGAGAAGT TTCTGATCGA AAAGTTCGAC AGCGTCTCCG ACCTGATGCA 2851 GCTCTCGGAG GGCGAAGAAT CTCGTGCTTT CAGCTTCGAT GTAGGAGGGC 2901 GTGGATATGT CCTGCGGGTA AATAGCTGCG CCGATGGTTT CTACAAAGAT 2951 CGTTATGTTT ATCGGCACTT TGCATCGGCC GCGCTCCCGA TTCCGGAAGT 3001 GCTTGACATT GGGGAATTCA GCGAGAGCCT GACCTATTGC ATCTCCCGCC 3051 GTGCACAGGG TGTCACGTTG CAAGACCTGC CTGAAACCGA ACTGCCCGCT 3101 GTTCTGCAGC CGGTCGCGGA GGCCATGGAT GCGATCGCTG CGGCCGATCT 3151 TAGCCAGACG AGCGGGTTCG GCCCATTCGG ACCGCAAGGA ATCGGTCAAT 3201 ACACTACATG GCGTGATTTC ATATGCGCGA TTGCTGATCC CCATGTGTAT 3251 CACTGGCAAA CTGTGATGGA CGACACCGTC AGTGCGTCCG TCGCGCAGGC 3301 TCTCGATGAG CTGATGCTTT GGGCCGAGGA CTGCCCCGAA GTCCGGCACC 3351 TCGTGCACGC GGATTTCGGC TCCAACAATG TCCTGACGGA CAATGGCCGC 3401 ATAACAGCGG TCATTGACTG GAGCGAGGCG ATGTTCGGGG ATTCCCAATA 3451 CGAGGTCGCC AACATCTTCT TCTGGAGGCC GTGGTTGGCT TGTATGGAGC 3501 AGCAGACGCG CTACTTCGAG CGGAGGCATC CGGAGCTTGC AGGATCGCCG 3551 CGGCTCCGGG CGTATATGCT CCGCATTGGT CTTGACCAAC TCTATCAGAG 3601 CTTGGTTGAC GGCAATTTCG ATGATGCAGC TTGGGCGCAG GGTCGATGCG 3651 ACGCAATCGT CCGATCCGGA GCCGGGACTG TCGGGCGTAC ACAAATCGCC 3701 CGCAGAAGCG CGGCCGTCTG GACCGATGGC TGTGTAGAAG TACTCGCCGA 3751 TAGTGGAAAC CGACGCCCCA GCACTCGTCC GAGGGCAAAG GAATAGCACG 3801 TGCTACGAGA TTTCGATTCC ACCGCCGCCT TCTATGAAAG GTTGGGCTTC 3851 GGAATCGTTT TCCGGGACGC TGGCTGGATG ATCCTCCAGC GCGGGGATCT 3901 CATGCTGGAG TTCTTCGCCC ACCCCAACTT GTTTATTGCA GCTTATAATG 3951 GTTACAAATA AAGCAATAGC ATCACAAATT TCACAAATAA AGCATTTTTT 4001 TCACTGCATT CTAGTTGTGG TTTGTCCAAA CTCATCAATG TATCTTATCA 4051 TGTCTGTATA CCGTCGACCT CTAGCTAGAG CTTGGCGTAA TCATGGTCAT 4101 AGCTGTTTCC TGTGTGAAAT TGTTATCCGC TCACAATTCC ACACAACATA 4151 CGAGCCGGAA GCATAAAGTG TAAAGCCTGG GGTGCCTAAT GAGTGAGCTA 4201 ACTCACATTA ATTGCGTTGC GCTCACTGCC CGCTTTCCAG TCGGGAAACC 4251 TGTCGTGCCA GCTGCATTAA TGAATCGGCC AACGCGCGGG GAGAGGCGGT 4301 TTGCGTATTG GGCGCTCTTC CGCTTCCTCG CTCACTGACT CGCTGCGCTC 4351 GGTCGTTCGG CTGCGGCGAG CGGTATCAGC TCACTCAAAG GCGGTAATAC 4401 GGTTATCCAC AGAATCAGGG GATAACGCAG GAAAGAACAT GTGAGCAAAA 4451 GGCCAGCAAA AGGCCAGGAA CCGTAAAAAG GCCGCGTTGC TGGCGTTTTT 4501 CCATAGGCTC CGCCCCCCTG ACGAGCATCA CAAAAATCGA CGCTCAAGTC 4551 AGAGGTGGCG AAACCCGACA GGACTATAAA GATACCAGGC GTTTCCCCCT 4601 GGAAGCTCCC TCGTGCGCTC TCCTGTTCCG ACCCTGCCGC TTACCGGATA 4651 CCTGTCCGCC TTTCTCCCTT CGGGAAGCGT GGCGCTTTCT CATAGCTCAC 4701 GCTGTAGGTA TCTCAGTTCG GTGTAGGTCG TTCGCTCCAA GCTGGGCTGT 4751 GTGCACGAAC CCCCCGTTCA GCCCGACCGC TGCGCCTTAT CCGGTAACTA 4801 TCGTCTTGAG TCCAACCCGG TAAGACACGA CTTATCGCCA CTGGCAGCAG 4851 CCACTGGTAA CAGGATTAGC AGAGCGAGGT ATGTAGGCGG TGCTACAGAG 4901 TTCTTGAAGT GGTGGCCTAA CTACGGCTAC ACTAGAAGAA CAGTATTTGG 4951 TATCTGCGCT CTGCTGAAGC CAGTTACCTT CGGAAAAAGA GTTGGTAGCT 5001 CTTGATCCGG CAAACAAACC ACCGCTGGTA GCGGTGGTTT TTTTGTTTGC 5051 AAGCAGCAGA TTACGCGCAG AAAAAAAGGA TCTCAAGAAG ATCCTTTGAT 5101 CTTTTCTACG GGGTCTGAGC GCGGAACCCC TATTTGTTTA TTTTTCTAAA 5151 TACATTCAAA TATGTATCCG CTCATGAATT AATTCTTAGA AAAACTCATC 5201 GAGCATCAAA TGAAACTGCA ATTTATTCAT ATCAGGATTA TCAATACCAT 5251 ATTTTTGAAA AAGCCGTTTC TGTAATGAAG GAGAAAACTC ACCGAGGCAG 5301 TTCCATAGGA TGGCAAGATC CTGGTATCGG TCTGCGATTC CGACTCGTCC 5351 AACATCAATA CAACCTATTA ATTTCCCCTC GTCAAAAATA AGGTTATCAA 5401 GTGAGAAATC ACCATGAGTG ACGACTGAAT CCGGTGAGAA TGGCAAAAGT 5451 TTATGCATTT CTTTCCAGAC TTGTTCAACA GGCCAGCCAT TACGCTCGTC 5501 ATCAAAATCA CTCGCATCAA CCAAACCGTT ATTCATTCGT GATTGCGCCT 5551 GAGCGAGACG AAATACGCGA TCGCTGTTAA AAGGACAATT ACAAACAGGA 5601 ATCGAATGCA ACCGGCGCAG GAACACTGCC AGCGCATCAA CAATATTTTC 5651 ACCTGAATCA GGATATTCTT CTAATACCTG GAATGCTGTT TTCCCAGGGA 5701 TCGCAGTGGT GAGTAACCAT GCATCATCAG GAGTACGGAT AAAATGCTTG 5751 ATGGTCGGAA GAGGCATAAA TTCCGTCAGC CAGTTTAGTC TGACCATCTC 5801 ATCTGTAACA TCATTGGCAA CGCTACCTTT GCCATGTTTC AGAAACAACT 5851 CTGGCGCATC GGGCTTCCCA TACAATCGAT AGATTGTCGC ACCTGATTGC 5901 CCGACATTAT CGCGAGCCCA TTTATACCCA TATAAATCAG CATCCATGTT 5951 GGAATTTAAT CGCGGCCTAG AGCAAGACGT TTCCCGTTGA ATATGGCTCA 6001 TAACACCCCT TGTATTACTG TTTATGTAAG CAGACAGTTT TATTGTTCAT 6051 GACCAAAATC CCTTAACGTG AGTTTTCGTT CCACTGAGCG TCAGACCCCG 6101 TAGAAATCCG CGCACATTTC CCCGAAAAGT GCCACCTGAC GTC
Vector Tag
DDK (Flag), N-terminus
Tag Information
DDK (Flag)-tag, or DDK (Flag) octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed proteins from wild-type proteins expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits. A DDK (Flag)-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a DDK (Flag)-tag to this protein allows one to follow the protein with an antibody against the DDK (Flag) sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis. The peptide sequence of the DDK (Flag)-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine-tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g. M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g. M2) are position-insensitive.
Usage Summary
Most commercially available competent cells are appropriate for propagation of the plasmid, e.g. TOP10, DH5a, and TOP10F’.
About GNRH2
O43555 NM_001501 NP_001492.1

Publications (0)

Customer Reviews (0)

Images

GNRH2 NucleicAcid

GNRH2 NucleicAcid

GNRH2 NucleicAcid

GNRH2 NucleicAcid

Requested From: United States
Date Requested: 8/10/2020