Products
Services
Research Areas
COVID-19
Resources
Contact Us
Distributors
Login
Quick Order
Cart
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Services
Immunohistochemistry Services

Work with LifeSpan to design a custom immunohistochemistry to address your specific biological question. Outsource the entire localization process without having to worry about finding and characterizing target specific antibodies, sourcing and validating difficult-to-find tissues, and having the ability to interpret the resulting immunostaining in relation to complex human pathologies.

TCR Screening Services

Test your therapeutic antibodies in immunohistochemistry against a broad panel of normal frozen human tissue types in order to determine potential unintended binding. Our non-GLP TCR services are designed on the FDA recommendation outlined in their "Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use".

Research Areas
Cell Cycle Pathways
Protein Family And Group
Infectious Disease
Contact Us
LSBio
2401 Fourth Avenue Suite 900
Seattle WA 98121
Phone:
866-819-4732 (Toll Free North America
206-374-1102 (International)
Fax:
866-206-6909 (Toll Free North America)
206-577-4565 (International)
How To Buy - Details about how to buy our products.
Orders@LSBio.com - To submit a new order.
Customer.Support@LSBio.com - To submit questions about existing orders, pricing, availability, bulk quotes, froforma invoice requests, or other billing issues.
Technical.Support@LSBio.com - To request technical information about an LSBio product or its applications
Sales@LSBio.com - To request information about fee-for-service contract IHC studies, IHC reports, distribution agreements, or general business development.
Worldwide Distributors List - To find your local distributor if you're not within the United States.
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Catalog Number Size Price
LS-N53203-1 1 Each $196 
DBI / ACBD1 NucleicAcid

Human DBI / ACBD1 Expression-Ready ORF Clone (pCMV3-C-Myc) LS-N53203

Human DBI / ACBD1 Expression-Ready ORF Clone (pCMV3-C-Myc) LS-N53203

Description:
Human DBI / ACBD1 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-C-Myc, with C-Terminal Myc tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-C-Myc
Other formats:
Price
Catalog Number
$196 
LS-N53203-1
1 Each

Estimated Shipping: 20 Business Days
Toll Free North America
866-819-4732
For Research Use Only

Overview

Description:
Human DBI / ACBD1 Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-C-Myc, with C-Terminal Myc tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-C-Myc
Other formats:

Specifications

Type
Expression-Ready ORF Clone
Target
DBI / ACBD1
Synonyms
DBI | ACBP | Acyl-CoA-binding protein | CCK-RP | ACBD1 | GABA receptor modulator | EP | Endozepine
Species
Human
Insert Size
315 bp
Cloning Enzymes Used
This construct is not yet assembled.
Presentation
Lyophilized
Reconstitution
  • Centrifuge at 5,000 x g for 5 minutes.
  • Carefully open the tube and add 100 µl of sterile water to dissolve the DNA.
  • Close the tube and incubate for 10 minutes at room temperature.
  • Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5,000 x g.
  • Store the plasmid at -20°C.
Storage
Store lyophilized at room temperature for up to three months.
Validation
The insert is confirmed by full-length sequencing with the sequencing primers listed.
Restrictions
For research use only. Intended for use by laboratory professionals.
Guarantee
This Expression-Ready ORF Clone carries the LSBio 100% Guarantee.
LSBio Guarantee
Vector
pCMV3-C-Myc
Vector Type
Expression Vector
Vector Information
All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
  • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
  • Hygromycin resistance gene for selection in mammalian cell lines.
  • A Kozak consensus sequence to enhance mammalian expression.
CMV promoter: p 250-837
Enhancer: bp 838-1445
SV40 early promoter: bp 2405-2774
Hygromycin ORF: bp 2792-3817
pUC origin: bp 4460-5133
Kanamycin ORF: bp 5207-6022
Expression System
Mammalian
Expression Method
Constitutive, Stable/Transient
Promoter
CMV
Sequencing Primers
T7 - 5' TAATACGACTCACTATAGGG 3'
BGH - 5' TAGAAGGCACAGTCGAGG 3'
Vector Size
6164 bp
Vector Sequence
1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTGCACTCT CAGTACAATC 51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT 101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG 151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG 201 CTGCTTCGCG AGTACATTTA TATTGGCTCA TGTCCAATAT GACCGCCATG 251 TTGACATTGA TTATTGACTA GTTATTAATA GTAATCAATT ACGGGGTCAT 301 TAGTTCATAG CCCATATATG GAGTTCCGCG TTACATAACT TACGGTAAAT 351 GGCCCGCCTG GCTGACCGCC CAACGACCCC CGCCCATTGA CGTCAATAAT 401 GACGTATGTT CCCATAGTAA CGCCAATAGG GACTTTCCAT TGACGTCAAT 451 GGGTGGAGTA TTTACGGTAA ACTGCCCACT TGGCAGTACA TCAAGTGTAT 501 CATATGCCAA GTCCGCCCCC TATTGACGTC AATGACGGTA AATGGCCCGC 551 CTGGCATTAT GCCCAGTACA TGACCTTACG GGACTTTCCT ACTTGGCAGT 601 ACATCTACGT ATTAGTCATC GCTATTACCA TGGTGATGCG GTTTTGGCAG 651 TACACCAATG GGCGTGGATA GCGGTTTGAC TCACGGGGAT TTCCAAGTCT 701 CCACCCCATT GACGTCAATG GGAGTTTGTT TTGGCACCAA AATCAACGGG 751 ACTTTCCAAA ATGTCGTAAT AACCCCGCCC CGTTGACGCA AATGGGCGGT 801 AGGCGTGTAC GGTGGGAGGT CTATATAAGC AGAGCTCGTT TAGTGAACCG 851 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTTGG 901 GCTCGCGGTT GAGGACAAAC TCTTCGCGGT CTTTCCAGTA CTCTTGGATC 951 GGAAACCCGT CGGCCTCCGA ACGGTACTCC GCCACCGAGG GACCTGAGCG 1001 AGTCCGCATC GACCGGATCG GAAAACCTCT CGAGAAAGGC GTCTAACCAG 1051 TCACAGTCGC AAGGTAGGCT GAGCACCGTG GCGGGCGGCA GCGGGTGGCG 1101 GTCGGGGTTG TTTCTGGCGG AGGTGCTGCT GATGATGTAA TTAAAGTAGG 1151 CGGTCTTGAG ACGGCGGATG GTCGAGGTGA GGTGTGGGTT TAGTGAACCG 1201 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTCAG 1251 GCTTGAGATC CAGCTGTTGG GGTGAGTACT CCCTCTCAAA AGCGGGCATT 1301 ACTTCTGCGC TAAGATTGTC AGTTTCCAAA AACGAGGAGG ATTTGATATT 1351 CACCTGGCCC GATCTGGCCA TACACTTGAG TGACAATGAC ATCCACTTTG 1401 CCTTTCTCTC CACAGGTGTC CACTCCCAGG TCCAAGTTTA AACTTTAATA 1451 CGACTCACTA TAGGGGCCGC CACCAAGCTT GGTACCGCTA GCGGATCCGT 1501 TAACCTTAAG ACCGGTATGG GCTGGTCCTG CATCATCCTG TTCCTCGTGG 1551 CGACCGCGAC CGGGGTCCAC AGCGATATCA TCGATAGCGC TCCCGGGGGT 1601 GGAGGCTCTG AGCAGAAACT CATCTCAGAA GAGGATCTGT AAACTCGAGT 1651 CTAGAGCGGC CGCCGAATTC GGGCCCGTTT AAACCCGCTG ATCAGCCTCG 1701 ACTGTGCCTT CTAGTTGCCA GCCATCTGTT GTTTGCCCCT CCCCCGTGCC 1751 TTCCTTGACC CTGGAAGGTG CCACTCCCAC TGTCCTTTCC TAATAAAATG 1801 AGGAAATTGC ATCGCATTGT CTGAGTAGGT GTCATTCTAT TCTGGGGGGT 1851 GGGGTGGGGC AGGACAGCAA GGGGGAGGAT TGGGAAGACA ATAGCAGGCA 1901 TGCTGGGGAT GCGGTGGGCT CTATGGCTTC TGAGGCGGAA AGAACCAGCT 1951 GGGGCTCTAG GGGGTATCCC CACGCGCCCT GTAGCGGCGC ATTAAGCGCG 2001 GCGGGTGTGG TGGTTACGCG CAGCGTGACC GCTACACTTG CCAGCGCCCT 2051 AGCGCCCGCT CCTTTCGCTT TCTTCCCTTC CTTTCTCGCC ACGTTCGCAG 2101 GCTTTCCCCG TCAAGCTCTA AATCGGGGGC TCCCTTTAGG GTTCCGATTT 2151 AGTGCTTTAC GGCACCTCGA CCCCAAAAAA CTTGATTAGG GTGATGGTTC 2201 ACGTAGTGGG CCATCGCCCT GATAGACGGT TTTTCGCCCT TTGACGTTGG 2251 AGTCCACGTT CTTTAATAGT GGACTCTTGT TCCAAACTGG AACAACACTC 2301 AACCCTATCT CGGTCTATTC TTTTGATTTA TAAGGGATTT TGCCGATTTC 2351 GGCCTATTGG TTAAAAAATG AGCTGATTTA ACAAAAATTT AACGCGAATT 2401 AATTCTGTGG AATGTGTGTC AGTTAGGGTG TGGAAAGTCC CCAGGCTCCC 2451 CAGCAGGCAG AAGTATGCAA AGCATGCATC TCAATTAGTC AGCAACCAGG 2501 TGTGGAAAGT CCCCAGGCTC CCCAGCAGGC AGAAGTATGC AAAGCATGCA 2551 TCTCAATTAG TCAGCAACCA TAGTCCCGCC CCTAACTCCG CCCATCCCGC 2601 CCCTAACTCC GCCCAGTTCC GCCCATTCTC CGCCCCATGG CTGACTAATT 2651 TTTTTTATTT ATGCAGAGGC CGAGGCCGCC TCTGCCTCTG AGCTATTCCA 2701 GAAGTAGTGA GGAGGCTTTT TTGGAGGCCT AGGCTTTTGC AAAAAGCTCT 2751 CGGGAGCTTG TATATCCATT TTCGGATCTG ATCAGCACGT GATGAAAAAG 2801 CCTGAACTCA CCGCGACGTC TGTCGAGAAG TTTCTGATCG AAAAGTTCGA 2851 CAGCGTCTCC GACCTGATGC AGCTCTCGGA GGGCGAAGAA TCTCGTGCTT 2901 TCAGCTTCGA TGTAGGAGGG CGTGGATATG TCCTGCGGGT AAATAGCTGC 2951 GCCGATGGTT TCTACAAAGA TCGTTATGTT TATCGGCACT TTGCATCGGC 3001 CGCGCTCCCG ATTCCGGAAG TGCTTGACAT TGGGGAATTC AGCGAGAGCC 3051 TGACCTATTG CATCTCCCGC CGTGCACAGG GTGTCACGTT GCAAGACCTG 3101 CCTGAAACCG AACTGCCCGC TGTTCTGCAG CCGGTCGCGG AGGCCATGGA 3151 TGCGATCGCT GCGGCCGATC TTAGCCAGAC GAGCGGGTTC GGCCCATTCG 3201 GACCGCAAGG AATCGGTCAA TACACTACAT GGCGTGATTT CATATGCGCG 3251 ATTGCTGATC CCCATGTGTA TCACTGGCAA ACTGTGATGG ACGACACCGT 3301 CAGTGCGTCC GTCGCGCAGG CTCTCGATGA GCTGATGCTT TGGGCCGAGG 3351 ACTGCCCCGA AGTCCGGCAC CTCGTGCACG CGGATTTCGG CTCCAACAAT 3401 GTCCTGACGG ACAATGGCCG CATAACAGCG GTCATTGACT GGAGCGAGGC 3451 GATGTTCGGG GATTCCCAAT ACGAGGTCGC CAACATCTTC TTCTGGAGGC 3501 CGTGGTTGGC TTGTATGGAG CAGCAGACGC GCTACTTCGA GCGGAGGCAT 3551 CCGGAGCTTG CAGGATCGCC GCGGCTCCGG GCGTATATGC TCCGCATTGG 3601 TCTTGACCAA CTCTATCAGA GCTTGGTTGA CGGCAATTTC GATGATGCAG 3651 CTTGGGCGCA GGGTCGATGC GACGCAATCG TCCGATCCGG AGCCGGGACT 3701 GTCGGGCGTA CACAAATCGC CCGCAGAAGC GCGGCCGTCT GGACCGATGG 3751 CTGTGTAGAA GTACTCGCCG ATAGTGGAAA CCGACGCCCC AGCACTCGTC 3801 CGAGGGCAAA GGAATAGCAC GTGCTACGAG ATTTCGATTC CACCGCCGCC 3851 TTCTATGAAA GGTTGGGCTT CGGAATCGTT TTCCGGGACG CTGGCTGGAT 3901 GATCCTCCAG CGCGGGGATC TCATGCTGGA GTTCTTCGCC CACCCCAACT 3951 TGTTTATTGC AGCTTATAAT GGTTACAAAT AAAGCAATAG CATCACAAAT 4001 TTCACAAATA AAGCATTTTT TTCACTGCAT TCTAGTTGTG GTTTGTCCAA 4051 ACTCATCAAT GTATCTTATC ATGTCTGTAT ACCGTCGACC TCTAGCTAGA 4101 GCTTGGCGTA ATCATGGTCA TAGCTGTTTC CTGTGTGAAA TTGTTATCCG 4151 CTCACAATTC CACACAACAT ACGAGCCGGA AGCATAAAGT GTAAAGCCTG 4201 GGGTGCCTAA TGAGTGAGCT AACTCACATT AATTGCGTTG CGCTCACTGC 4251 CCGCTTTCCA GTCGGGAAAC CTGTCGTGCC AGCTGCATTA ATGAATCGGC 4301 CAACGCGCGG GGAGAGGCGG TTTGCGTATT GGGCGCTCTT CCGCTTCCTC 4351 GCTCACTGAC TCGCTGCGCT CGGTCGTTCG GCTGCGGCGA GCGGTATCAG 4401 CTCACTCAAA GGCGGTAATA CGGTTATCCA CAGAATCAGG GGATAACGCA 4451 GGAAAGAACA TGTGAGCAAA AGGCCAGCAA AAGGCCAGGA ACCGTAAAAA 4501 GGCCGCGTTG CTGGCGTTTT TCCATAGGCT CCGCCCCCCT GACGAGCATC 4551 ACAAAAATCG ACGCTCAAGT CAGAGGTGGC GAAACCCGAC AGGACTATAA 4601 AGATACCAGG CGTTTCCCCC TGGAAGCTCC CTCGTGCGCT CTCCTGTTCC 4651 GACCCTGCCG CTTACCGGAT ACCTGTCCGC CTTTCTCCCT TCGGGAAGCG 4701 TGGCGCTTTC TCATAGCTCA CGCTGTAGGT ATCTCAGTTC GGTGTAGGTC 4751 GTTCGCTCCA AGCTGGGCTG TGTGCACGAA CCCCCCGTTC AGCCCGACCG 4801 CTGCGCCTTA TCCGGTAACT ATCGTCTTGA GTCCAACCCG GTAAGACACG 4851 ACTTATCGCC ACTGGCAGCA GCCACTGGTA ACAGGATTAG CAGAGCGAGG 4901 TATGTAGGCG GTGCTACAGA GTTCTTGAAG TGGTGGCCTA ACTACGGCTA 4951 CACTAGAAGA ACAGTATTTG GTATCTGCGC TCTGCTGAAG CCAGTTACCT 5001 TCGGAAAAAG AGTTGGTAGC TCTTGATCCG GCAAACAAAC CACCGCTGGT 5051 AGCGGTGGTT TTTTTGTTTG CAAGCAGCAG ATTACGCGCA GAAAAAAAGG 5101 ATCTCAAGAA GATCCTTTGA TCTTTTCTAC GGGGTCTGAG CGCGGAACCC 5151 CTATTTGTTT ATTTTTCTAA ATACATTCAA ATATGTATCC GCTCATGAAT 5201 TAATTCTTAG AAAAACTCAT CGAGCATCAA ATGAAACTGC AATTTATTCA 5251 TATCAGGATT ATCAATACCA TATTTTTGAA AAAGCCGTTT CTGTAATGAA 5301 GGAGAAAACT CACCGAGGCA GTTCCATAGG ATGGCAAGAT CCTGGTATCG 5351 GTCTGCGATT CCGACTCGTC CAACATCAAT ACAACCTATT AATTTCCCCT 5401 CGTCAAAAAT AAGGTTATCA AGTGAGAAAT CACCATGAGT GACGACTGAA 5451 TCCGGTGAGA ATGGCAAAAG TTTATGCATT TCTTTCCAGA CTTGTTCAAC 5501 AGGCCAGCCA TTACGCTCGT CATCAAAATC ACTCGCATCA ACCAAACCGT 5551 TATTCATTCG TGATTGCGCC TGAGCGAGAC GAAATACGCG ATCGCTGTTA 5601 AAAGGACAAT TACAAACAGG AATCGAATGC AACCGGCGCA GGAACACTGC 5651 CAGCGCATCA ACAATATTTT CACCTGAATC AGGATATTCT TCTAATACCT 5701 GGAATGCTGT TTTCCCAGGG ATCGCAGTGG TGAGTAACCA TGCATCATCA 5751 GGAGTACGGA TAAAATGCTT GATGGTCGGA AGAGGCATAA ATTCCGTCAG 5801 CCAGTTTAGT CTGACCATCT CATCTGTAAC ATCATTGGCA ACGCTACCTT 5851 TGCCATGTTT CAGAAACAAC TCTGGCGCAT CGGGCTTCCC ATACAATCGA 5901 TAGATTGTCG CACCTGATTG CCCGACATTA TCGCGAGCCC ATTTATACCC 5951 ATATAAATCA GCATCCATGT TGGAATTTAA TCGCGGCCTA GAGCAAGACG 6001 TTTCCCGTTG AATATGGCTC ATAACACCCC TTGTATTACT GTTTATGTAA 6051 GCAGACAGTT TTATTGTTCA TGACCAAAAT CCCTTAACGT GAGTTTTCGT 6101 TCCACTGAGC GTCAGACCCC GTAGAAATCC GCGCACATTT CCCCGAAAAG 6151 TGCCACCTGA CGTC
Vector Tag
Myc, C-terminus
Tag Information
A Myc-tag is a polypeptide protein tag derived from the c-Myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed proteins from wild type proteins expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits. A Myc-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a Myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting. The peptide sequence of the Myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.
Usage Summary
Most commercially available competent cells are appropriate for propagation of the plasmid, e.g. TOP10, DH5a, and TOP10F’.
About DBI / ACBD1
P07108 NM_020548 NP_065438.1

Publications (0)

Customer Reviews (0)

Images

DBI / ACBD1 NucleicAcid

DBI / ACBD1 NucleicAcid

DBI / ACBD1 NucleicAcid

DBI / ACBD1 NucleicAcid

Requested From: United States
Date Requested: 8/6/2020