Products
Services
Research Areas
COVID-19
Resources
Contact Us
Distributors
Login
Quick Order
Cart
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Services
Immunohistochemistry Services

Work with LifeSpan to design a custom immunohistochemistry to address your specific biological question. Outsource the entire localization process without having to worry about finding and characterizing target specific antibodies, sourcing and validating difficult-to-find tissues, and having the ability to interpret the resulting immunostaining in relation to complex human pathologies.

TCR Screening Services

Test your therapeutic antibodies in immunohistochemistry against a broad panel of normal frozen human tissue types in order to determine potential unintended binding. Our non-GLP TCR services are designed on the FDA recommendation outlined in their "Points to Consider in the Manufacture and Testing of Monoclonal Antibody Products for Human Use".

Research Areas
Cell Cycle Pathways
Protein Family And Group
Infectious Disease
Contact Us
LSBio
2401 Fourth Avenue Suite 900
Seattle WA 98121
Phone:
866-819-4732 (Toll Free North America
206-374-1102 (International)
Fax:
866-206-6909 (Toll Free North America)
206-577-4565 (International)
How To Buy - Details about how to buy our products.
Orders@LSBio.com - To submit a new order.
Customer.Support@LSBio.com - To submit questions about existing orders, pricing, availability, bulk quotes, froforma invoice requests, or other billing issues.
Technical.Support@LSBio.com - To request technical information about an LSBio product or its applications
Sales@LSBio.com - To request information about fee-for-service contract IHC studies, IHC reports, distribution agreements, or general business development.
Worldwide Distributors List - To find your local distributor if you're not within the United States.
Login
Registration enables users to use special features of this website, such as past
order histories, retained contact details for faster checkout, review submissions, and special promotions.


Fields marked with a * are required.

Login
Quick Order
Catalog Number Size Price
LS-N55505-1 1 Each $225 
BOULE / BOLL NucleicAcid

Human BOULE / BOLL Expression-Ready ORF Clone (pCMV3-C-OFP) LS-N55505

Human BOULE / BOLL Expression-Ready ORF Clone (pCMV3-C-OFP) LS-N55505

Description:
Human BOULE / BOLL Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-C-OFP, with C-Terminal OFP tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-C-OFP
Other formats:
Price
Catalog Number
$225 
LS-N55505-1
1 Each

Estimated Shipping: 20 Business Days
Toll Free North America
866-819-4732
For Research Use Only

Overview

Description:
Human BOULE / BOLL Expression-Ready ORF Clone in Mammalian Expression Vector pCMV3-C-OFP, with C-Terminal OFP tag. Approximately 10 ug per unit.
Vector:
Expression Vector pCMV3-C-OFP
Other formats:

Specifications

Type
Expression-Ready ORF Clone
Target
BOULE / BOLL
Synonyms
BOLL | Bol, boule-like (Drosophila) | Protein boule-like | BOULE
Species
Human
Insert Size
852 bp
Cloning Enzymes Used
This construct is not yet assembled.
Presentation
Lyophilized
Reconstitution
  • Centrifuge at 5,000 x g for 5 minutes.
  • Carefully open the tube and add 100 µl of sterile water to dissolve the DNA.
  • Close the tube and incubate for 10 minutes at room temperature.
  • Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5,000 x g.
  • Store the plasmid at -20°C.
Storage
Store lyophilized at room temperature for up to three months.
Validation
The insert is confirmed by full-length sequencing with the sequencing primers listed.
Restrictions
For research use only. Intended for use by laboratory professionals.
Guarantee
This Expression-Ready ORF Clone carries the LSBio 100% Guarantee.
LSBio Guarantee
Vector
pCMV3-C-OFP
Vector Type
Expression Vector
Vector Information
All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
  • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
  • Hygromycin resistance gene for selection in mammalian cell lines.
  • A Kozak consensus sequence to enhance mammalian expression.
CMV promoter: bp 250-837
Enhancer: bp 838-1445
SV40 early promoter: bp 3047-3416
Hygromycin ORF: bp 3932-3930
pUC origin: bp 5102-5775
Kanamycin ORF: bp 5849-6664
Expression System
Mammalian
Expression Method
Constitutive, Stable/Transient
Promoter
CMV
Sequencing Primers
T7 - 5' TAATACGACTCACTATAGGG 3'
BGH - 5' TAGAAGGCACAGTCGAGG 3'
Vector Size
6806 bp
Vector Sequence
1 GACGGATCGG GAGATCTCCC GATCCCCTAT GGTGCACTCT CAGTACAATC 51 TGCTCTGATG CCGCATAGTT AAGCCAGTAT CTGCTCCCTG CTTGTGTGTT 101 GGAGGTCGCT GAGTAGTGCG CGAGCAAAAT TTAAGCTACA ACAAGGCAAG 151 GCTTGACCGA CAATTGCATG AAGAATCTGC TTAGGGTTAG GCGTTTTGCG 201 CTGCTTCGCG AGTACATTTA TATTGGCTCA TGTCCAATAT GACCGCCATG 251 TTGACATTGA TTATTGACTA GTTATTAATA GTAATCAATT ACGGGGTCAT 301 TAGTTCATAG CCCATATATG GAGTTCCGCG TTACATAACT TACGGTAAAT 351 GGCCCGCCTG GCTGACCGCC CAACGACCCC CGCCCATTGA CGTCAATAAT 401 GACGTATGTT CCCATAGTAA CGCCAATAGG GACTTTCCAT TGACGTCAAT 451 GGGTGGAGTA TTTACGGTAA ACTGCCCACT TGGCAGTACA TCAAGTGTAT 501 CATATGCCAA GTCCGCCCCC TATTGACGTC AATGACGGTA AATGGCCCGC 551 CTGGCATTAT GCCCAGTACA TGACCTTACG GGACTTTCCT ACTTGGCAGT 601 ACATCTACGT ATTAGTCATC GCTATTACCA TGGTGATGCG GTTTTGGCAG 651 TACACCAATG GGCGTGGATA GCGGTTTGAC TCACGGGGAT TTCCAAGTCT 701 CCACCCCATT GACGTCAATG GGAGTTTGTT TTGGCACCAA AATCAACGGG 751 ACTTTCCAAA ATGTCGTAAT AACCCCGCCC CGTTGACGCA AATGGGCGGT 801 AGGCGTGTAC GGTGGGAGGT CTATATAAGC AGAGCTCGTT TAGTGAACCG 851 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTTGG 901 GCTCGCGGTT GAGGACAAAC TCTTCGCGGT CTTTCCAGTA CTCTTGGATC 951 GGAAACCCGT CGGCCTCCGA ACGGTACTCC GCCACCGAGG GACCTGAGCG 1001 AGTCCGCATC GACCGGATCG GAAAACCTCT CGAGAAAGGC GTCTAACCAG 1051 TCACAGTCGC AAGGTAGGCT GAGCACCGTG GCGGGCGGCA GCGGGTGGCG 1101 GTCGGGGTTG TTTCTGGCGG AGGTGCTGCT GATGATGTAA TTAAAGTAGG 1151 CGGTCTTGAG ACGGCGGATG GTCGAGGTGA GGTGTGGGTT TAGTGAACCG 1201 TCAGATCCTC ACTCTCTTCC GCATCGCTGT CTGCGAGGGC CAGCTGTCAG 1251 GCTTGAGATC CAGCTGTTGG GGTGAGTACT CCCTCTCAAA AGCGGGCATT 1301 ACTTCTGCGC TAAGATTGTC AGTTTCCAAA AACGAGGAGG ATTTGATATT 1351 CACCTGGCCC GATCTGGCCA TACACTTGAG TGACAATGAC ATCCACTTTG 1401 CCTTTCTCTC CACAGGTGTC CACTCCCAGG TCCAAGTTTA AACTTTAATA 1451 CGACTCACTA TAGGGGCCGC CACCAAGCTT GGTACCGCTA GCGGATCCGT 1501 TAACCTTAAG ACCGGTATGG GCTGGTCCTG CATCATCCTG TTCCTCGTGG 1551 CGACCGCGAC CGGGGTCCAC AGCGATATCA TCGATAGCGC TCCCGGGGGT 1601 GGAGGCTCTG ATAGCACTGA GAACGTCATC AAGCCCTTCA TGCGCTTCAA 1651 GGTGCACATG GAGGGCTCCG TGAACGGCCA CGAGTTCGAG ATCGAGGGCG 1701 TGGGCGAGGG CCGCCCCTAC GAGGGCTTTC AGACCGCTAA GCTGAAGGTG 1751 ACCAAGGGTG GCCCCCTGCC CTTCGCCTGG GACATCCTGT CCCCTCATTT 1801 CACCTACGGC TCCAAGGCCT ACGTGAAGCA CCCCGCCGAC ATCCCCGACT 1851 ACTTGAAGCT GTCCTTCCCC GAGGGCTTCA AGTGGGAGCG CGTGATGAAC 1901 TACGAGGACG GCGGCGTGGT GACCGTGACC CAGGACTCCT CCCTACAGGA 1951 CGGCGAGTTC ATCTACAAGG TGAAGCTGCG CGGCACCAAC TTCCCCTCCG 2001 ACGGCCCCGT GATGCAGAAG AAGACCATGG GCTGGGAGGC CTCCTCCGAG 2051 CGGATGTACC CCGAGGACGG TGCCCTGAAG GGCAAGATCA AGATGAGGCT 2101 GAAGCTGAAG GACGGCGGCC ACTACACCTC CGAGGTCAAG ACCACCTACA 2151 AGGCCAAGAA GCCCGTGCAG CTGCCCGGCG CCTACATCGT CGACATCAAG 2201 TTGGACATCA CCTCCCACAA CGAGGACTAC ACCATCGTGG AACAGTACGA 2251 ACGCGCCGAG GGCCGCCACC ACCTGTTCCA GTAAACTCGA GTCTAGAGCG 2301 GCCGCCGAAT TCGGGCCCGT TTAAACCCGC TGATCAGCCT CGACTGTGCC 2351 TTCTAGTTGC CAGCCATCTG TTGTTTGCCC CTCCCCCGTG CCTTCCTTGA 2401 CCCTGGAAGG TGCCACTCCC ACTGTCCTTT CCTAATAAAA TGAGGAAATT 2451 GCATCGCATT GTCTGAGTAG GTGTCATTCT ATTCTGGGGG GTGGGGTGGG 2501 GCAGGACAGC AAGGGGGAGG ATTGGGAAGA CAATAGCAGG CATGCTGGGG 2551 ATGCGGTGGG CTCTATGGCT TCTGAGGCGG AAAGAACCAG CTGGGGCTCT 2601 AGGGGGTATC CCCACGCGCC CTGTAGCGGC GCATTAAGCG CGGCGGGTGT 2651 GGTGGTTACG CGCAGCGTGA CCGCTACACT TGCCAGCGCC CTAGCGCCCG 2701 CTCCTTTCGC TTTCTTCCCT TCCTTTCTCG CCACGTTCGC AGGCTTTCCC 2751 CGTCAAGCTC TAAATCGGGG GCTCCCTTTA GGGTTCCGAT TTAGTGCTTT 2801 ACGGCACCTC GACCCCAAAA AACTTGATTA GGGTGATGGT TCACGTAGTG 2851 GGCCATCGCC CTGATAGACG GTTTTTCGCC CTTTGACGTT GGAGTCCACG 2901 TTCTTTAATA GTGGACTCTT GTTCCAAACT GGAACAACAC TCAACCCTAT 2951 CTCGGTCTAT TCTTTTGATT TATAAGGGAT TTTGCCGATT TCGGCCTATT 3001 GGTTAAAAAA TGAGCTGATT TAACAAAAAT TTAACGCGAA TTAATTCTGT 3051 GGAATGTGTG TCAGTTAGGG TGTGGAAAGT CCCCAGGCTC CCCAGCAGGC 3101 AGAAGTATGC AAAGCATGCA TCTCAATTAG TCAGCAACCA GGTGTGGAAA 3151 GTCCCCAGGC TCCCCAGCAG GCAGAAGTAT GCAAAGCATG CATCTCAATT 3201 AGTCAGCAAC CATAGTCCCG CCCCTAACTC CGCCCATCCC GCCCCTAACT 3251 CCGCCCAGTT CCGCCCATTC TCCGCCCCAT GGCTGACTAA TTTTTTTTAT 3301 TTATGCAGAG GCCGAGGCCG CCTCTGCCTC TGAGCTATTC CAGAAGTAGT 3351 GAGGAGGCTT TTTTGGAGGC CTAGGCTTTT GCAAAAAGCT CTCGGGAGCT 3401 TGTATATCCA TTTTCGGATC TGATCAGCAC GTGATGAAAA AGCCTGAACT 3451 CACCGCGACG TCTGTCGAGA AGTTTCTGAT CGAAAAGTTC GACAGCGTCT 3501 CCGACCTGAT GCAGCTCTCG GAGGGCGAAG AATCTCGTGC TTTCAGCTTC 3551 GATGTAGGAG GGCGTGGATA TGTCCTGCGG GTAAATAGCT GCGCCGATGG 3601 TTTCTACAAA GATCGTTATG TTTATCGGCA CTTTGCATCG GCCGCGCTCC 3651 CGATTCCGGA AGTGCTTGAC ATTGGGGAAT TCAGCGAGAG CCTGACCTAT 3701 TGCATCTCCC GCCGTGCACA GGGTGTCACG TTGCAAGACC TGCCTGAAAC 3751 CGAACTGCCC GCTGTTCTGC AGCCGGTCGC GGAGGCCATG GATGCGATCG 3801 CTGCGGCCGA TCTTAGCCAG ACGAGCGGGT TCGGCCCATT CGGACCGCAA 3851 GGAATCGGTC AATACACTAC ATGGCGTGAT TTCATATGCG CGATTGCTGA 3901 TCCCCATGTG TATCACTGGC AAACTGTGAT GGACGACACC GTCAGTGCGT 3951 CCGTCGCGCA GGCTCTCGAT GAGCTGATGC TTTGGGCCGA GGACTGCCCC 4001 GAAGTCCGGC ACCTCGTGCA CGCGGATTTC GGCTCCAACA ATGTCCTGAC 4051 GGACAATGGC CGCATAACAG CGGTCATTGA CTGGAGCGAG GCGATGTTCG 4101 GGGATTCCCA ATACGAGGTC GCCAACATCT TCTTCTGGAG GCCGTGGTTG 4151 GCTTGTATGG AGCAGCAGAC GCGCTACTTC GAGCGGAGGC ATCCGGAGCT 4201 TGCAGGATCG CCGCGGCTCC GGGCGTATAT GCTCCGCATT GGTCTTGACC 4251 AACTCTATCA GAGCTTGGTT GACGGCAATT TCGATGATGC AGCTTGGGCG 4301 CAGGGTCGAT GCGACGCAAT CGTCCGATCC GGAGCCGGGA CTGTCGGGCG 4351 TACACAAATC GCCCGCAGAA GCGCGGCCGT CTGGACCGAT GGCTGTGTAG 4401 AAGTACTCGC CGATAGTGGA AACCGACGCC CCAGCACTCG TCCGAGGGCA 4451 AAGGAATAGC ACGTGCTACG AGATTTCGAT TCCACCGCCG CCTTCTATGA 4501 AAGGTTGGGC TTCGGAATCG TTTTCCGGGA CGCTGGCTGG ATGATCCTCC 4551 AGCGCGGGGA TCTCATGCTG GAGTTCTTCG CCCACCCCAA CTTGTTTATT 4601 GCAGCTTATA ATGGTTACAA ATAAAGCAAT AGCATCACAA ATTTCACAAA 4651 TAAAGCATTT TTTTCACTGC ATTCTAGTTG TGGTTTGTCC AAACTCATCA 4701 ATGTATCTTA TCATGTCTGT ATACCGTCGA CCTCTAGCTA GAGCTTGGCG 4751 TAATCATGGT CATAGCTGTT TCCTGTGTGA AATTGTTATC CGCTCACAAT 4801 TCCACACAAC ATACGAGCCG GAAGCATAAA GTGTAAAGCC TGGGGTGCCT 4851 AATGAGTGAG CTAACTCACA TTAATTGCGT TGCGCTCACT GCCCGCTTTC 4901 CAGTCGGGAA ACCTGTCGTG CCAGCTGCAT TAATGAATCG GCCAACGCGC 4951 GGGGAGAGGC GGTTTGCGTA TTGGGCGCTC TTCCGCTTCC TCGCTCACTG 5001 ACTCGCTGCG CTCGGTCGTT CGGCTGCGGC GAGCGGTATC AGCTCACTCA 5051 AAGGCGGTAA TACGGTTATC CACAGAATCA GGGGATAACG CAGGAAAGAA 5101 CATGTGAGCA AAAGGCCAGC AAAAGGCCAG GAACCGTAAA AAGGCCGCGT 5151 TGCTGGCGTT TTTCCATAGG CTCCGCCCCC CTGACGAGCA TCACAAAAAT 5201 CGACGCTCAA GTCAGAGGTG GCGAAACCCG ACAGGACTAT AAAGATACCA 5251 GGCGTTTCCC CCTGGAAGCT CCCTCGTGCG CTCTCCTGTT CCGACCCTGC 5301 CGCTTACCGG ATACCTGTCC GCCTTTCTCC CTTCGGGAAG CGTGGCGCTT 5351 TCTCATAGCT CACGCTGTAG GTATCTCAGT TCGGTGTAGG TCGTTCGCTC 5401 CAAGCTGGGC TGTGTGCACG AACCCCCCGT TCAGCCCGAC CGCTGCGCCT 5451 TATCCGGTAA CTATCGTCTT GAGTCCAACC CGGTAAGACA CGACTTATCG 5501 CCACTGGCAG CAGCCACTGG TAACAGGATT AGCAGAGCGA GGTATGTAGG 5551 CGGTGCTACA GAGTTCTTGA AGTGGTGGCC TAACTACGGC TACACTAGAA 5601 GAACAGTATT TGGTATCTGC GCTCTGCTGA AGCCAGTTAC CTTCGGAAAA 5651 AGAGTTGGTA GCTCTTGATC CGGCAAACAA ACCACCGCTG GTAGCGGTGG 5701 TTTTTTTGTT TGCAAGCAGC AGATTACGCG CAGAAAAAAA GGATCTCAAG 5751 AAGATCCTTT GATCTTTTCT ACGGGGTCTG AGCGCGGAAC CCCTATTTGT 5801 TTATTTTTCT AAATACATTC AAATATGTAT CCGCTCATGA ATTAATTCTT 5851 AGAAAAACTC ATCGAGCATC AAATGAAACT GCAATTTATT CATATCAGGA 5901 TTATCAATAC CATATTTTTG AAAAAGCCGT TTCTGTAATG AAGGAGAAAA 5951 CTCACCGAGG CAGTTCCATA GGATGGCAAG ATCCTGGTAT CGGTCTGCGA 6001 TTCCGACTCG TCCAACATCA ATACAACCTA TTAATTTCCC CTCGTCAAAA 6051 ATAAGGTTAT CAAGTGAGAA ATCACCATGA GTGACGACTG AATCCGGTGA 6101 GAATGGCAAA AGTTTATGCA TTTCTTTCCA GACTTGTTCA ACAGGCCAGC 6151 CATTACGCTC GTCATCAAAA TCACTCGCAT CAACCAAACC GTTATTCATT 6201 CGTGATTGCG CCTGAGCGAG ACGAAATACG CGATCGCTGT TAAAAGGACA 6251 ATTACAAACA GGAATCGAAT GCAACCGGCG CAGGAACACT GCCAGCGCAT 6301 CAACAATATT TTCACCTGAA TCAGGATATT CTTCTAATAC CTGGAATGCT 6351 GTTTTCCCAG GGATCGCAGT GGTGAGTAAC CATGCATCAT CAGGAGTACG 6401 GATAAAATGC TTGATGGTCG GAAGAGGCAT AAATTCCGTC AGCCAGTTTA 6451 GTCTGACCAT CTCATCTGTA ACATCATTGG CAACGCTACC TTTGCCATGT 6501 TTCAGAAACA ACTCTGGCGC ATCGGGCTTC CCATACAATC GATAGATTGT 6551 CGCACCTGAT TGCCCGACAT TATCGCGAGC CCATTTATAC CCATATAAAT 6601 CAGCATCCAT GTTGGAATTT AATCGCGGCC TAGAGCAAGA CGTTTCCCGT 6651 TGAATATGGC TCATAACACC CCTTGTATTA CTGTTTATGT AAGCAGACAG 6701 TTTTATTGTT CATGACCAAA ATCCCTTAAC GTGAGTTTTC GTTCCACTGA 6751 GCGTCAGACC CCGTAGAAAT CCGCGCACAT TTCCCCGAAA AGTGCCACCT 6801 GACGTC
Vector Tag
OFP, C-terminus
Tag Information
An OFP-tag is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, the OFP-tag is more than twice brighter than mOrange2. The OFP-tag's fast maturation makes it clearly detectable in mammalian cells as early as 8 hours after transfection. The OFP-tag can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFP-tagged expression vectors produce bright fluorescence within 8 hours after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, the OFP-tag performs well in some fusion and protein labeling applications.
Usage Summary
Most commercially available competent cells are appropriate for propagation of the plasmid, e.g. TOP10, DH5a, and TOP10F’.
About BOULE / BOLL
Q8N9W6 Q8N9W6

Publications (0)

Customer Reviews (0)

Images

BOULE / BOLL NucleicAcid

BOULE / BOLL NucleicAcid

BOULE / BOLL NucleicAcid

BOULE / BOLL NucleicAcid

Requested From: United States
Date Requested: 8/13/2020